Construct: ORF TRCN0000475458
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011005.1_s317c1
- Derived from:
- ccsbBroadEn_05554
- DNA Barcode:
- CCATTGACATCAGCTAAAAATATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CENPS (378708)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475458
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100526739 | CENPS-CORT | CENPS-CORT readthrough | NM_001270517.2 | 100% | 100% | |
| 2 | human | 378708 | CENPS | centromere protein S | NM_199294.3 | 100% | 100% | |
| 3 | human | 100526739 | CENPS-CORT | CENPS-CORT readthrough | NM_198544.4 | 67.6% | 60.6% | (many diffs) |
| 4 | human | 100526739 | CENPS-CORT | CENPS-CORT readthrough | NM_199006.3 | 54.6% | 50% | (many diffs) |
| 5 | human | 378708 | CENPS | centromere protein S | NR_036462.2 | 28.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 480
- ORF length:
- 414
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggaggaggcg gagaccgagg agcagcagcg attctcttac caacagaggc 121 taaaggcagc agttcactat actgtgggtt gtctttgcga ggaagttgca ttggacaaag 181 agatgcagtt cagcaaacag accattgcgg ccatttcgga gctgactttc cgacagtgtg 241 aaaattttgc caaagacctt gaaatGTTTG CAAGACATGC GAAAAGAACC ACAATTAACA 301 CTGAAGATGT GAAGCTCTTA GCCAGGAGGA GTAATTCACT GCTAAAATAC ATCACAGACA 361 AAAGTGAAGA GATTGCTCAG ATTAACCTAG AACGAAAAGC ACAGAAGAAA AAGAAGTCAG 421 AGGATGGAAG CAAAAATTCA AGGCAGCCAG CAGAGGCTGG AGTGGTGGAA AGTGAGAATT 481 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 541 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 601 TTTATATATC TTGTGGAAAG GACGACCATT GACATCAGCT AAAAATATAA CGCGTTAAGT 661 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt