Transcript: Human NM_199294.3

Homo sapiens centromere protein S (CENPS), transcript variant A, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CENPS (378708)
Length:
905
CDS:
86..502

Additional Resources:

NCBI RefSeq record:
NM_199294.3
NBCI Gene record:
CENPS (378708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262596 CTTAGCCAGGAGGAGTAATTC pLKO_005 337 CDS 100% 13.200 6.600 Y CENPS n/a
2 TRCN0000282342 ACAGACCATTGCGGCCATTTC pLKO_005 217 CDS 100% 10.800 5.400 Y CENPS n/a
3 TRCN0000262599 TCTTACCAACAGAGGCTAAAG pLKO_005 125 CDS 100% 10.800 5.400 Y CENPS n/a
4 TRCN0000262598 TTTGCCAAAGACCTTGAAATG pLKO_005 266 CDS 100% 10.800 5.400 Y CENPS n/a
5 TRCN0000191787 GCCAAAGACCTTGAAATGTTT pLKO.1 269 CDS 100% 5.625 2.813 Y Apitd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05554 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05554 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475458 CCATTGACATCAGCTAAAAATATA pLX_317 51.8% 100% 100% V5 n/a
Download CSV