Construct: ORF TRCN0000475478
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016906.1_s317c1
- Derived from:
- ccsbBroadEn_05017
- DNA Barcode:
- TGAGTCTCCTTCTGAGCTTATATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HJV (148738)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475478
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 148738 | HJV | hemojuvelin BMP co-receptor | NM_001316767.2 | 100% | 100% | |
| 2 | human | 148738 | HJV | hemojuvelin BMP co-receptor | NM_202004.4 | 100% | 100% | |
| 3 | human | 148738 | HJV | hemojuvelin BMP co-receptor | NM_213652.4 | 100% | 100% | |
| 4 | human | 148738 | HJV | hemojuvelin BMP co-receptor | NM_145277.5 | 63.8% | 63.8% | 1_339del |
| 5 | human | 148738 | HJV | hemojuvelin BMP co-receptor | NM_213653.3 | 46.9% | 46.9% | 1_678del |
| 6 | human | 148738 | HJV | hemojuvelin BMP co-receptor | XM_005272932.1 | 46.9% | 46.9% | 1_678del |
| 7 | mouse | 69585 | Hfe2 | hemochromatosis type 2 (juv... | NM_027126.4 | 40.8% | 42.1% | (many diffs) |
| 8 | mouse | 69585 | Hfe2 | hemochromatosis type 2 (juv... | XM_006502037.3 | 40.8% | 42.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 666
- ORF length:
- 600
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggaatgcatt gatcagaagg tgtatcaggc tgaggtggat aatcttcctg 121 tagcctttga agatggttct atcaatggag gtgaccgacc tgggggatcc agtttgtcga 181 ttcaaactgc taaccctggg aaccatgtgg agatccaagc tgcctacatt ggcacaacta 241 taatcattcg gcagacagct gggcagctct ccttctccat caaggtagca gaggatgtgg 301 ccatggcctt ctcagctgaa caggacctgc agctctgtgt tggggggtgC CCTCCAAGTC 361 AGCGACTCTC TCGATCAGAG CGCAATCGTC GGGGAGCTAT AACCATTGAT ACTGCCAGAC 421 GGCTGTGCAA GGAAGGGCTT CCAGTGGAAG ATGCTTACTT CCATTCCTGT GTCTTTGATG 481 TTTTAATTTC TGGTGATCCC AACTTTACCG TGGCAGCTCA GGCAGCACTG GAGGATGCCC 541 GAGCCTTCCT GCCAGACTTA GAGAAGCTGC ATCTCTTCCC CTCAGATGCT GGGGTTCCTC 601 TTTCCTCAGC AACCCTCTTA GCTCCACTCC TTTCTGGGCT CTTTGTTCTG TGGCTTTGCA 661 TTCAGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 721 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 781 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGAGTCTCC TTCTGAGCTT ATATTACGCG 841 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt