Transcript: Human NM_213653.3

Homo sapiens hemojuvelin BMP co-receptor (HJV), transcript variant a, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
HJV (148738)
Length:
2234
CDS:
326..1606

Additional Resources:

NCBI RefSeq record:
NM_213653.3
NBCI Gene record:
HJV (148738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415792 GACATGATCATTAGCCATAAG pLKO_005 1975 3UTR 100% 10.800 15.120 N HJV n/a
2 TRCN0000118662 CCTTATAAGTTTAGAGGTCAT pLKO.1 1887 3UTR 100% 4.050 5.670 N HJV n/a
3 TRCN0000118663 GCCTACATTGGCACAACTATA pLKO.1 1160 CDS 100% 13.200 10.560 N HJV n/a
4 TRCN0000118665 GAAGCTCACCATCATATTTAA pLKO.1 979 CDS 100% 15.000 10.500 N HJV n/a
5 TRCN0000454968 ATTAGGGAAAGAAGTCTATTT pLKO_005 2018 3UTR 100% 13.200 9.240 N HJV n/a
6 TRCN0000118664 CCGGAAGCTCACCATCATATT pLKO.1 976 CDS 100% 13.200 9.240 N HJV n/a
7 TRCN0000418479 TATCAGGCTGAGGTGGATAAT pLKO_005 1031 CDS 100% 13.200 9.240 N HJV n/a
8 TRCN0000122735 CCTAGGAGACACGTGAAACAA pLKO.1 1697 3UTR 100% 5.625 3.938 N HJV n/a
9 TRCN0000118666 TGTGACTATGAAGGCCGGTTT pLKO.1 767 CDS 100% 4.050 2.835 N HJV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05017 pDONR223 100% 46.9% 46.9% None 1_678del n/a
2 ccsbBroad304_05017 pLX_304 0% 46.9% 46.9% V5 1_678del n/a
3 TRCN0000475478 TGAGTCTCCTTCTGAGCTTATATT pLX_317 52.7% 46.9% 46.9% V5 1_678del n/a
Download CSV