Transcript: Human NM_202004.4

Homo sapiens hemojuvelin BMP co-receptor (HJV), transcript variant c, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
HJV (148738)
Length:
1417
CDS:
208..810

Additional Resources:

NCBI RefSeq record:
NM_202004.4
NBCI Gene record:
HJV (148738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_202004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415792 GACATGATCATTAGCCATAAG pLKO_005 1179 3UTR 100% 10.800 15.120 N HJV n/a
2 TRCN0000118662 CCTTATAAGTTTAGAGGTCAT pLKO.1 1091 3UTR 100% 4.050 5.670 N HJV n/a
3 TRCN0000118663 GCCTACATTGGCACAACTATA pLKO.1 364 CDS 100% 13.200 10.560 N HJV n/a
4 TRCN0000454968 ATTAGGGAAAGAAGTCTATTT pLKO_005 1222 3UTR 100% 13.200 9.240 N HJV n/a
5 TRCN0000418479 TATCAGGCTGAGGTGGATAAT pLKO_005 235 CDS 100% 13.200 9.240 N HJV n/a
6 TRCN0000122735 CCTAGGAGACACGTGAAACAA pLKO.1 901 3UTR 100% 5.625 3.938 N HJV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_202004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05017 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05017 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475478 TGAGTCTCCTTCTGAGCTTATATT pLX_317 52.7% 100% 100% V5 n/a
Download CSV