Construct: ORF TRCN0000475487
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000486.1_s317c1
- Derived from:
- ccsbBroadEn_12936
- DNA Barcode:
- CTCTTATATACGTTTCCCCCTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OTULIN (90268)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475487
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_017010015.1 | 80.1% | 80.1% | 1_159del |
| 2 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | NM_138348.6 | 60.7% | 60.7% | 1_414del |
| 3 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514151.2 | 60.7% | 60.7% | 1_414del |
| 4 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514152.2 | 60.7% | 60.7% | 1_414del |
| 5 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514154.2 | 35.2% | 35.2% | 1_414del;592_593ins270 |
| 6 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | XM_006520105.1 | 69.1% | 71.9% | (many diffs) |
| 7 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | XM_006520104.1 | 55.7% | 58% | (many diffs) |
| 8 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | NM_001013792.2 | 52.4% | 54.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 708
- ORF length:
- 642
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ccaggctgtg gggctgccgc cctggctgca ggacccggag ctcatgctgt 121 taccagaaaa actcataagc aaatacaact ggatcaagca atggaaactt ggactgaaat 181 ttgatgggaa gaatgaggac ctggttgata aaattaaaga gtcccttact ctgctgagga 241 agaagtgggc aggcttggct gaaatgagaa ctgctgaagc aagacagata gcttgtgatg 301 aactattcac aaatgaggcg gaggaatata gcctctatga agctgtaaaa tttctaatgc 361 taaacagagc cattgaacta tataatgata aagagaaagg aaaggaagta ccatttttct 421 ctgtgcttct gtttgctcgg gacacatcaa atgacccagg acagcttctg aggaaccacc 481 tcaaccaggt gggacacacT GGTGGTCTTG AACAGGTTGA AATGTTCCTT CTTGCCTATG 541 CTGTGCGCCA CACCATCCAG GTGTACCGGC TCTCCAAGTA CAACACGGAA GAATTCATCA 601 CAGTCTACCC CACCGACCCA CCCAAGGACT GGCCAGTGGT AACGCTCATT GCTGAGGACG 661 ATCGGCACTA TAACATCCCC GTCAGAGTGT GTGAGGAGAC CAGTCTATGC CCAACTTTCT 721 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 781 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 841 GTGGAAAGGA CGACTCTTAT ATACGTTTCC CCCTAATACG CGTTAAGTCg acaatcaacc 901 tctggattac aaaatttgtg aaagatt