Construct: ORF TRCN0000475514
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001168.1_s317c1
- Derived from:
- ccsbBroadEn_09552
- DNA Barcode:
- AGCATCAAGATGCGATCTCCCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATPSCKMT (134145)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475514
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NM_199133.4 | 99.7% | 99.5% | 207G>A;224C>T |
| 2 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NM_001258388.1 | 92.4% | 92.2% | 207G>A;224C>T;443_444ins51 |
| 3 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | XM_011513964.2 | 72.1% | 73.3% | (many diffs) |
| 4 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NM_001258389.1 | 67.5% | 58.7% | (many diffs) |
| 5 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NR_047670.1 | 25.2% | (many diffs) | |
| 6 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NR_047669.1 | 24.2% | (many diffs) | |
| 7 | human | 134145 | ATPSCKMT | ATP synthase c subunit lysi... | NR_047668.1 | 23.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 765
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gggaggagga ggtatacccc tagaaacact taaagaagaa agtcagtcaa 121 gacatgttct acctgcaagt tttgaagtca acagtttgca gaaaagcaac tgggggttct 181 tacttactgg gcttgtgggt ggcaccctgg tggctgtgta cgctgtagcc acgccgtttg 241 taacgccagc ccttcgaaaa gtctgtttgc catttgtacc tgcaactatg aagcagattg 301 aaaatgttgt gaaaatgttg cgatgccgaa gaggatccct tgtggacatc ggtagtgggg 361 acggacgcat tgtcatagcg gctgcgaaga aagggttcac agcagttggt tatgaattaa 421 acccatggct agtttggtat tccagatacc gcgcttggcG AGAAGGTGTG CATGGATCTG 481 CCAAATTTTA TATTTCAGAT TTGTGGAAGG TTACTTTTTC GCAGTACTCG AACGTTGTTA 541 TTTTCGGTGT GCCTCAGATG ATGCTGCAGT TGGAGAAGAA ACTTGAACGT GAACTTGAGG 601 ATGATGCACG AGTTATTGCT TGCCGGTTCC CTTTCCCACA TTGGACTCCA GACCACGTCA 661 CGGGGGAGGG GATAGACACA GTGTGGGCAT ATGATGCAAG CACTTTTAGA GGCCGTGAAA 721 AGAGGCCCTG TACATCGATG CATTTCCAGC TGCCCATTCA AGCATACCCA ACTTTCTTGT 781 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 841 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 901 GAAAGGACGA AGCATCAAGA TGCGATCTCC CCGTACGCGT TAAGTCgaca atcaacctct 961 ggattacaaa atttgtgaaa gatt