Transcript: Human NM_001258388.1

Homo sapiens ATP synthase c subunit lysine N-methyltransferase (ATPSCKMT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-04
Taxon:
Homo sapiens (human)
Gene:
ATPSCKMT (134145)
Length:
2621
CDS:
37..687

Additional Resources:

NCBI RefSeq record:
NM_001258388.1
NBCI Gene record:
ATPSCKMT (134145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172721 GCCCTGTACATCGATGCATTT pLKO.1 645 CDS 100% 10.800 15.120 N ATPSCKMT n/a
2 TRCN0000168730 GCCTCGATAAGGAGAAATGAT pLKO.1 1009 3UTR 100% 5.625 7.875 N ATPSCKMT n/a
3 TRCN0000422103 GGATTCAGAGAGGCGTTTATA pLKO_005 1140 3UTR 100% 15.000 10.500 N ATPSCKMT n/a
4 TRCN0000420475 CTTAGCAAAGGAGCATAATTG pLKO_005 757 3UTR 100% 13.200 9.240 N ATPSCKMT n/a
5 TRCN0000167625 GAGAAGAAACTTGAACGTGAA pLKO.1 493 CDS 100% 4.050 2.835 N ATPSCKMT n/a
6 TRCN0000168839 CTTGAACGTGAACTTGAGGAT pLKO.1 502 CDS 100% 2.640 1.848 N ATPSCKMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09552 pDONR223 100% 92.4% 92.2% None 207G>A;224C>T;443_444ins51 n/a
2 ccsbBroad304_09552 pLX_304 0% 92.4% 92.2% V5 207G>A;224C>T;443_444ins51 n/a
3 TRCN0000475514 AGCATCAAGATGCGATCTCCCCGT pLX_317 43.9% 92.4% 92.2% V5 207G>A;224C>T;443_444ins51 n/a
Download CSV