Transcript: Human NM_199133.4

Homo sapiens ATP synthase c subunit lysine N-methyltransferase (ATPSCKMT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-04
Taxon:
Homo sapiens (human)
Gene:
ATPSCKMT (134145)
Length:
2651
CDS:
16..717

Additional Resources:

NCBI RefSeq record:
NM_199133.4
NBCI Gene record:
ATPSCKMT (134145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415598 GCAGTACTCGAACGTTGTTAT pLKO_005 471 CDS 100% 13.200 18.480 N ATPSCKMT n/a
2 TRCN0000172721 GCCCTGTACATCGATGCATTT pLKO.1 675 CDS 100% 10.800 15.120 N ATPSCKMT n/a
3 TRCN0000168730 GCCTCGATAAGGAGAAATGAT pLKO.1 1039 3UTR 100% 5.625 7.875 N ATPSCKMT n/a
4 TRCN0000422103 GGATTCAGAGAGGCGTTTATA pLKO_005 1170 3UTR 100% 15.000 10.500 N ATPSCKMT n/a
5 TRCN0000420475 CTTAGCAAAGGAGCATAATTG pLKO_005 787 3UTR 100% 13.200 9.240 N ATPSCKMT n/a
6 TRCN0000167625 GAGAAGAAACTTGAACGTGAA pLKO.1 523 CDS 100% 4.050 2.835 N ATPSCKMT n/a
7 TRCN0000168839 CTTGAACGTGAACTTGAGGAT pLKO.1 532 CDS 100% 2.640 1.848 N ATPSCKMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09552 pDONR223 100% 99.7% 99.5% None 207G>A;224C>T n/a
2 ccsbBroad304_09552 pLX_304 0% 99.7% 99.5% V5 207G>A;224C>T n/a
3 TRCN0000475514 AGCATCAAGATGCGATCTCCCCGT pLX_317 43.9% 99.7% 99.5% V5 207G>A;224C>T n/a
Download CSV