Construct: ORF TRCN0000475532
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011594.1_s317c1
- Derived from:
- ccsbBroadEn_04869
- DNA Barcode:
- ATTCTAGTCAACACACTACTTGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPNE4 (131034)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475532
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 131034 | CPNE4 | copine 4 | NM_130808.2 | 100% | 100% | |
| 2 | human | 131034 | CPNE4 | copine 4 | XM_024453339.1 | 100% | 100% | |
| 3 | human | 131034 | CPNE4 | copine 4 | NM_001289112.1 | 96.8% | 96.8% | 1_54del |
| 4 | human | 131034 | CPNE4 | copine 4 | NM_153429.1 | 96.8% | 96.8% | 1_54del |
| 5 | human | 131034 | CPNE4 | copine 4 | XM_024453338.1 | 96.2% | 96.2% | 1_66del |
| 6 | human | 131034 | CPNE4 | copine 4 | XM_011512406.2 | 79.7% | 79.7% | 0_1ins339 |
| 7 | human | 131034 | CPNE4 | copine 4 | XM_011512407.2 | 79.7% | 79.7% | 0_1ins339 |
| 8 | human | 131034 | CPNE4 | copine 4 | XM_011512408.2 | 79.7% | 79.7% | 0_1ins339 |
| 9 | human | 131034 | CPNE4 | copine 4 | XM_024453340.1 | 79.7% | 79.7% | 0_1ins339 |
| 10 | human | 131034 | CPNE4 | copine 4 | XM_017005694.2 | 74.9% | 74.9% | 1_66del;1368_1369ins369 |
| 11 | human | 131034 | CPNE4 | copine 4 | XM_017005695.2 | 68.9% | 55.1% | (many diffs) |
| 12 | human | 131034 | CPNE4 | copine 4 | XM_017005696.1 | 54.9% | 54.9% | 0_1ins753 |
| 13 | mouse | 74020 | Cpne4 | copine IV | NM_028719.1 | 91.2% | 99.4% | (many diffs) |
| 14 | mouse | 74020 | Cpne4 | copine IV | XM_006511840.3 | 88.4% | 96.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1737
- ORF length:
- 1671
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaagatgagc aacatttatg agtccgctgc caacacactg ggaatcttta 121 acagcccctg cctgaccaaa gttgagctgc gtgtggcgtg caaaggcatt tctgacagag 181 atgccctttc caaaccagac ccctgtgtca tcctcaagat gcagtctcat gggcagtggt 241 ttgaggttga caggactgag gtgattcgca cctgcataaa cccagtgtac tcaaaactgt 301 ttactgtgga cttttacttt gaggaggtgc agcgcctgcg gtttgaagtc catgacatca 361 gcagcaacca caatgggctg aaggaggccg acttccttgg tggcatggag tgcacacttg 421 gccagattgt ttcccagaga aagctgtcca aatccttgct gaagcatggg aacacagcag 481 ggaaatcttc catcacggtg attgctgaag aattatctgg caatgacgac tatgttgagc 541 ttgcattcaa tgcacggaaa ttggatgaca aggatttctt cagtaaatct gacccatttc 601 tggaaatttt tcgtatgaat gatgatgcaa ctcagcagct ggtgcaccga actgaggttg 661 tgatgaataa cttaagccca gcctggaaat cattcaaagt atctgtaaat tctctatgca 721 gcggagaccc agaccgccgg ctaaagtgca tagtatggga ctgggactcc aatggcaagc 781 atgacttcat tggagaattc acctcgacat tcaaggagat gagaggagca atggaaggga 841 aacaggtgca gtgggagtgc atcaatccca agtacaaagc caagaagaag aattacaaga 901 actcaggcac tgtgattctg aatctgtgca agattcacaa gatgcattct ttcttggact 961 acatcatggg tggctgccaa atccagttta cagtagctat agatttcact gcctcaaacg 1021 gggaccccag gaacagctgt tccttgcact acatccaccc ttaccaaccc aatgagtatc 1081 tgaaagcttt ggtagctgtg ggggagattt gccaagacta tgacagtgac aaaatgttcc 1141 ctgcctttgg gtttggcgcc aggatacctc cagagtacac ggtctctcat gactttgcaa 1201 tcaactttaa tgaagacaac ccagaatgtg caggaattca aggagttgtg gaagcctatc 1261 agagctgtct tcctaagctc caactctacg gtcccaccaa cattgccccc atcatccaga 1321 aggttgccaa gtcagcgtca gaggaaacta acaccaagga ggcatcgcaa tacttcatcc 1381 tgctgatcct gacagatggt gttatcacag acatggccga cacccgggag gccattgtcc 1441 atgcctccca cctccccatg tcagtcatca tcgtgggagt agggaacgct gacttcagtg 1501 acatgcagat gctggacggt gatgatggga tTCTGAGGTC ACCCAAGGGA GAGCCTGTTC 1561 TTCGAGACAT CGTCCAGTTC GTGCCCTTCA GGAACTTCAA ACACGCATCT CCAGCTGCCC 1621 TGGCAAAGAG CGTGCTGGCT GAAGTCCCAA ACCAAGTTGT GGACTATTAC AATGGCAAAG 1681 GAATTAAACC AAAATGTTCA TCAGAAATGT ATGAATCTTC CAGAACACTA GCACCATGCC 1741 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1801 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1861 ATATATCTTG TGGAAAGGAC GAATTCTAGT CAACACACTA CTTGGTACGC GTTAAGTCga 1921 caatcaacct ctggattaca aaatttgtga aagatt