Transcript: Human XM_017005696.1

PREDICTED: Homo sapiens copine 4 (CPNE4), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPNE4 (131034)
Length:
2694
CDS:
148..1068

Additional Resources:

NCBI RefSeq record:
XM_017005696.1
NBCI Gene record:
CPNE4 (131034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430757 GATCTGTTAAGCCCTTGTATT pLKO_005 1247 3UTR 100% 13.200 10.560 N CPNE4 n/a
2 TRCN0000155906 CCTTACCAACCCAATGAGTAT pLKO.1 388 CDS 100% 4.950 3.960 N CPNE4 n/a
3 TRCN0000416226 TACTATTCCTGCTAATATTTC pLKO_005 1100 3UTR 100% 13.200 9.240 N CPNE4 n/a
4 TRCN0000156395 CCCTTACCAACCCAATGAGTA pLKO.1 387 CDS 100% 4.950 3.465 N CPNE4 n/a
5 TRCN0000157373 CAAGGAGTTGTGGAAGCCTAT pLKO.1 568 CDS 100% 4.050 2.835 N CPNE4 n/a
6 TRCN0000418728 CAAACCAAGTTGTGGACTATT pLKO_005 977 CDS 100% 13.200 7.920 N CPNE4 n/a
7 TRCN0000158101 CAAGGAGGCATCGCAATACTT pLKO.1 684 CDS 100% 5.625 3.375 N CPNE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04869 pDONR223 100% 54.9% 54.9% None 0_1ins753 n/a
2 ccsbBroad304_04869 pLX_304 0% 54.9% 54.9% V5 0_1ins753 n/a
3 TRCN0000475532 ATTCTAGTCAACACACTACTTGGT pLX_317 12.7% 54.9% 54.9% V5 0_1ins753 n/a
Download CSV