Construct: ORF TRCN0000475647
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009225.1_s317c1
- Derived from:
- ccsbBroadEn_06095
- DNA Barcode:
- ATCATAACCAATTCTCTCAAACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DFFB (1677)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475647
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1677 | DFFB | DNA fragmentation factor su... | NM_004402.4 | 99.8% | 100% | 531G>A;954A>G |
| 2 | human | 1677 | DFFB | DNA fragmentation factor su... | NM_001282669.1 | 93.1% | 93% | 242_313del;603G>A;1026A>G |
| 3 | human | 1677 | DFFB | DNA fragmentation factor su... | NM_001320132.2 | 82.5% | 79.7% | (many diffs) |
| 4 | human | 1677 | DFFB | DNA fragmentation factor su... | XM_017000498.2 | 81.1% | 81.3% | 241_242ins189;342G>A;765A>G |
| 5 | human | 1677 | DFFB | DNA fragmentation factor su... | NM_001320136.2 | 78.2% | 78.1% | (many diffs) |
| 6 | human | 1677 | DFFB | DNA fragmentation factor su... | XM_017000500.1 | 71.4% | 68.3% | 531G>A;681_682ins101;726_727ins187 |
| 7 | human | 1677 | DFFB | DNA fragmentation factor su... | XM_017000499.1 | 66.7% | 63.5% | (many diffs) |
| 8 | human | 1677 | DFFB | DNA fragmentation factor su... | XR_002959574.1 | 56.9% | (many diffs) | |
| 9 | human | 1677 | DFFB | DNA fragmentation factor su... | XR_001737013.1 | 56.7% | (many diffs) | |
| 10 | human | 1677 | DFFB | DNA fragmentation factor su... | XR_946563.2 | 54.7% | (many diffs) | |
| 11 | human | 1677 | DFFB | DNA fragmentation factor su... | XR_946565.1 | 49.3% | (many diffs) | |
| 12 | human | 1677 | DFFB | DNA fragmentation factor su... | XM_011540865.2 | 40.8% | 39.5% | (many diffs) |
| 13 | human | 1677 | DFFB | DNA fragmentation factor su... | NR_135152.2 | 35.4% | (many diffs) | |
| 14 | human | 1677 | DFFB | DNA fragmentation factor su... | NR_135151.2 | 34.6% | (many diffs) | |
| 15 | human | 1677 | DFFB | DNA fragmentation factor su... | NR_135150.2 | 34.2% | (many diffs) | |
| 16 | human | 1677 | DFFB | DNA fragmentation factor su... | NR_104222.2 | 34% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1080
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ccagaagccc aagagcgtga agctgcgggc cctgcgcagc ccgaggaagt 121 tcggcgtggc tggccggagc tgccaggagg tgctgcgcaa gggctgtctc cgcttccagc 181 tccctgagcg cggttcccgg ctgtgcctgt acgaggatgg cacggagctg acggaagatt 241 acttccccag tgttcccgac aacgccgagc tggtgctgct caccttgggc caggcctggc 301 agggctatgt gagcgacatc aggcgcttcc tcagtgcatt tcacgagcca caggtggggc 361 tcatccaggc cgcccagcag ctgctgtgtg atgagcaggc cccacagagg cagaggctgc 421 tggctgacct cctgcacaac gtcagccaga acatcgcggc cgagacccgg gctgaggacc 481 cgccgtggtt tgaaggcttg gagtcccgat ttcagagcaa gtctggctat ctgagataca 541 gctgtgagag ccggatccgg agttacctga gggaggtgag ctcctacccc tccacagtgg 601 gtgcggaggc tcaggaggaa ttcctgcggg tcctcggctc catgtgccag aggctccggt 661 ccatgcagta caatggcagc tacttcgaca gaggagccaa gggcggcagc cgcctctgca 721 caccggaagg ctggttctcc tgccagggtc cctttgacat ggacagctgc ttatcaagac 781 actccatcaa cccctacagt aacagggaga gcaggatccT CTTCAGCACC TGGAACCTGG 841 ATCACATAAT AGAAAAGAAA CGCACCATCA TTCCTACACT GGTGGAAGCA ATTAAGGAAC 901 AAGATGGAAG AGAAGTGGAC TGGGAGTATT TTTATGGCCT GCTTTTTACC TCAGAGAACC 961 TAAAACTAGT GCACATTGTC TGCCATAAGA AAACCACCCA CAAGCTCAAC TGTGACCCGA 1021 GCAGAATCTA CAAACCCCAG ACAAGGTTGA AGCGGAAGCA GCCTGTGCGG AAACGCCAGT 1081 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1141 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1201 TTTATATATC TTGTGGAAAG GACGAATCAT AACCAATTCT CTCAAACTTA CGCGTTAAGT 1261 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt