Transcript: Human NR_135152.2

Homo sapiens DNA fragmentation factor subunit beta (DFFB), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DFFB (1677)
Length:
2855
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135152.2
NBCI Gene record:
DFFB (1677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428688 GAAGGCTTGGAGTCCCGATTT pLKO_005 577 3UTR 100% 10.800 15.120 N DFFB n/a
2 TRCN0000010812 GCGTTGGGTTTGCTCATGTAA pLKO.1 1760 3UTR 100% 5.625 7.875 N DFFB n/a
3 TRCN0000424383 ACACTGGTGGAAGCAATTAAG pLKO_005 961 3UTR 100% 13.200 9.240 N DFFB n/a
4 TRCN0000003705 CACGGAGCTGACGGAAGATTA pLKO.1 284 3UTR 100% 13.200 9.240 N DFFB n/a
5 TRCN0000421092 TGACATGGACAGCTGCTTATC pLKO_005 840 3UTR 100% 10.800 7.560 N DFFB n/a
6 TRCN0000003706 GCACAACGTCAGCCAGAACAT pLKO.1 519 3UTR 100% 4.950 3.465 N DFFB n/a
7 TRCN0000003707 GCTCCGGTCCATGCAGTACAA pLKO.1 738 3UTR 100% 1.650 1.155 N DFFB n/a
8 TRCN0000431635 TGTTTCCTCCAAATCTGATTT pLKO_005 1298 3UTR 100% 13.200 7.920 N DFFB n/a
9 TRCN0000003708 ACCTGGAACCTGGATCACATA pLKO.1 913 3UTR 100% 4.950 2.970 N DFFB n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2254 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2254 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06095 pDONR223 100% 35.4% None (many diffs) n/a
2 ccsbBroad304_06095 pLX_304 0% 35.4% V5 (many diffs) n/a
3 TRCN0000475647 ATCATAACCAATTCTCTCAAACTT pLX_317 26.2% 35.4% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 2.3% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 2.3% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV