Transcript: Human XR_946563.2

PREDICTED: Homo sapiens DNA fragmentation factor subunit beta (DFFB), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DFFB (1677)
Length:
1848
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946563.2
NBCI Gene record:
DFFB (1677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428688 GAAGGCTTGGAGTCCCGATTT pLKO_005 817 3UTR 100% 10.800 15.120 N DFFB n/a
2 TRCN0000424383 ACACTGGTGGAAGCAATTAAG pLKO_005 1201 3UTR 100% 13.200 9.240 N DFFB n/a
3 TRCN0000003705 CACGGAGCTGACGGAAGATTA pLKO.1 474 3UTR 100% 13.200 9.240 N DFFB n/a
4 TRCN0000421092 TGACATGGACAGCTGCTTATC pLKO_005 1080 3UTR 100% 10.800 7.560 N DFFB n/a
5 TRCN0000003706 GCACAACGTCAGCCAGAACAT pLKO.1 759 3UTR 100% 4.950 3.465 N DFFB n/a
6 TRCN0000003707 GCTCCGGTCCATGCAGTACAA pLKO.1 978 3UTR 100% 1.650 1.155 N DFFB n/a
7 TRCN0000003708 ACCTGGAACCTGGATCACATA pLKO.1 1153 3UTR 100% 4.950 2.970 N DFFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06095 pDONR223 100% 54.7% None (many diffs) n/a
2 ccsbBroad304_06095 pLX_304 0% 54.7% V5 (many diffs) n/a
3 TRCN0000475647 ATCATAACCAATTCTCTCAAACTT pLX_317 26.2% 54.7% V5 (many diffs) n/a
Download CSV