Transcript: Mouse NM_198607.1

Mus musculus thioesterase superfamily member 6 (Them6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Them6 (223626)
Length:
1600
CDS:
62..685

Additional Resources:

NCBI RefSeq record:
NM_198607.1
NBCI Gene record:
Them6 (223626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264696 TGTCAGCCTTCGCGATGGTTT pLKO_005 472 CDS 100% 4.950 6.930 N Them6 n/a
2 TRCN0000264698 ACCACTCTTAAGAGGATATAC pLKO_005 1158 3UTR 100% 13.200 9.240 N Them6 n/a
3 TRCN0000201170 GTAGTACAGCACTTGTGCAAA pLKO.1 548 CDS 100% 4.950 3.465 N Them6 n/a
4 TRCN0000264694 GTTTGAGCCGTTCGAGGTACA pLKO_005 400 CDS 100% 4.050 2.835 N Them6 n/a
5 TRCN0000264695 TTATTGGCGGAGCAGCGGTAT pLKO_005 191 CDS 100% 4.050 2.835 N Them6 n/a
6 TRCN0000216679 CATTGGATCTCCTACAATGAG pLKO.1 608 CDS 100% 0.495 0.347 N Them6 n/a
7 TRCN0000264697 TAGTACAGCACTTGTGCAAAC pLKO_005 549 CDS 100% 6.000 3.600 N Them6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475673 GGGAGTTAGACCTAAAGGTGGCCT pLX_317 36.8% 83.8% 87.5% V5 (many diffs) n/a
2 ccsbBroadEn_15064 pDONR223 91.1% 83.7% 85.6% None (many diffs) n/a
3 ccsbBroad304_15064 pLX_304 0% 83.7% 85.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV