Construct: ORF TRCN0000475746
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015688.1_s317c1
- Derived from:
- ccsbBroadEn_04023
- DNA Barcode:
- ACGCAATAGCGCGCACCTGGGCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLX1B (79008)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475746
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 548593 | SLX1A | SLX1 homolog A, structure-s... | NM_001014999.2 | 100% | 100% | |
| 2 | human | 79008 | SLX1B | SLX1 homolog B, structure-s... | NM_024044.4 | 100% | 100% | |
| 3 | human | 548593 | SLX1A | SLX1 homolog A, structure-s... | NM_001015000.2 | 58.5% | 58.5% | 239_240ins342 |
| 4 | human | 79008 | SLX1B | SLX1 homolog B, structure-s... | NM_178044.2 | 58.5% | 58.5% | 239_240ins342 |
| 5 | human | 100526831 | SLX1B-SULT1A4 | SLX1B-SULT1A4 readthrough (... | NR_037609.1 | 33% | (many diffs) | |
| 6 | human | 100526830 | SLX1A-SULT1A3 | SLX1A-SULT1A3 readthrough (... | NR_037608.1 | 32.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tcccgcgggg gtcgcggcga ggccagggcg ctttttcggc gtctacctgc 121 tctactgcct gaacccccgg taccggggcc gcgtctacgt ggggttcact gtcaacactg 181 ctcgtcgggt ccagcagcac aatgggggcc gcaaaaaagg cggggcctgg cggaccagcg 241 ggcgagggcc ctgggagatg gtgctcgtcg tgcacggctt cccgtcctcc gtggccgccc 301 ttcggtttga gtgggcttgg cagcacccgc acgcctcgcg ccgcctggcg cacgtggggc 361 ctcgcctgcg aggagagaca gccttcgctt tccacctgcg cgtgctggcg cacatgctgc 421 gcgcaccgcc ctgggctcgc ctcccgctca cgctgcgctg ggtgcgccca gacctccgcc 481 aggacctctg cctcccgccg ccgccgcacg tgcctctggc cttcgggcct ccaccgcccc 541 aggccccggc cccaaggcgc cgcgcaggtc cctttgatga cgcggagcct gagccagacc 601 agggggatcc aggggcctgc tgctCCCTGT GCGCCCAGAC CATCCAGGAT GAAGAGGGGC 661 CCTTGTGTTG CCCCCACCCT GGCTGCCTGC TAAGGGCCCA TGTGATCTGC CTGGCAGAGG 721 AGTTTCTTCA GGAAGAACCA GGGCAGCTTC TGCCCCTAGA GGGCCAATGC CCTTGCTGTG 781 AGAAGTCACT GCTTTGGGGA GACCTGATCT GGCTGTGCCA GATGGACACT GAGAAAGAAG 841 TAGAAGACTC AGAATTAGAA GAGGCACACT GGACAGACCT GCTGGAGACC TGCCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGAACGC AATAGCGCGC ACCTGGGCAA ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt