Transcript: Human NM_024044.4

Homo sapiens SLX1 homolog B, structure-specific endonuclease subunit (SLX1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLX1B (79008)
Length:
1165
CDS:
243..1070

Additional Resources:

NCBI RefSeq record:
NM_024044.4
NBCI Gene record:
SLX1B (79008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024044.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158328 CTGTGAGAAGTCACTGCTTTG pLKO.1 953 CDS 100% 6.000 3.000 Y SLX1B n/a
2 TRCN0000156158 CAGATGGACACTGAGAAAGAA pLKO.1 996 CDS 100% 5.625 2.813 Y SLX1B n/a
3 TRCN0000254863 TGCCTGGCAGAGGAGTTTCTT pLKO_005 885 CDS 100% 5.625 2.813 Y SLX1A n/a
4 TRCN0000254861 CCAGACCATCCAGGATGAAGA pLKO_005 812 CDS 100% 4.950 2.475 Y SLX1A n/a
5 TRCN0000156650 GCTGTGAGAAGTCACTGCTTT pLKO.1 952 CDS 100% 4.950 2.475 Y SLX1B n/a
6 TRCN0000265622 GTGCCAGATGGACACTGAGAA pLKO_005 992 CDS 100% 4.950 2.475 Y SLX1A n/a
7 TRCN0000267497 AGGAGAGACAGCCTTCGCTTT pLKO_005 548 CDS 100% 4.050 2.025 Y SLX1A n/a
8 TRCN0000254862 TTTCGGCGTCTACCTGCTCTA pLKO_005 281 CDS 100% 4.050 2.025 Y SLX1A n/a
9 TRCN0000155909 CAGAATTAGAAGAGGCACACT pLKO.1 1027 CDS 100% 2.640 1.320 Y SLX1B n/a
10 TRCN0000153141 GAAAGAAGTAGAAGACTCAGA pLKO.1 1010 CDS 100% 2.640 1.320 Y SLX1B n/a
11 TRCN0000153397 GAGAAAGAAGTAGAAGACTCA pLKO.1 1008 CDS 100% 2.640 1.320 Y SLX1B n/a
12 TRCN0000157042 GCAGAGGAGTTTCTTCAGGAA pLKO.1 891 CDS 100% 2.640 1.320 Y SLX1B n/a
13 TRCN0000154895 CTCAGAATTAGAAGAGGCACA pLKO.1 1025 CDS 100% 2.160 1.080 Y SLX1B n/a
14 TRCN0000154673 GACTCAGAATTAGAAGAGGCA pLKO.1 1023 CDS 100% 0.660 0.330 Y SLX1B n/a
15 TRCN0000155450 GAGGAGTTTCTTCAGGAAGAA pLKO.1 894 CDS 100% 0.495 0.248 Y SLX1B n/a
16 TRCN0000155322 GAGTTTCTTCAGGAAGAACCA pLKO.1 897 CDS 100% 0.264 0.132 Y SLX1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024044.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04023 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04023 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475746 ACGCAATAGCGCGCACCTGGGCAA pLX_317 32.7% 100% 100% V5 n/a
4 ccsbBroadEn_04022 pDONR223 100% 58.5% 58.5% None 240_581del n/a
5 ccsbBroad304_04022 pLX_304 0% 58.5% 58.5% V5 240_581del n/a
6 TRCN0000475441 TCGATCTGTCGCCTACCTTCGTTG pLX_317 64.2% 58.5% 58.5% V5 240_581del n/a
Download CSV