Construct: ORF TRCN0000475767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009851.1_s317c1
- Derived from:
- ccsbBroadEn_04858
- DNA Barcode:
- CCGCATATCCTAAATCCTAGTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CIB4 (130106)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 130106 | CIB4 | calcium and integrin bindin... | NM_001029881.3 | 100% | 100% | |
| 2 | human | 130106 | CIB4 | calcium and integrin bindin... | XM_011532514.2 | 89.5% | 81% | 0_1insATGGGGCA;44_99del |
| 3 | human | 130106 | CIB4 | calcium and integrin bindin... | XM_017003329.1 | 87% | 84.3% | (many diffs) |
| 4 | human | 130106 | CIB4 | calcium and integrin bindin... | XM_017003330.2 | 73.1% | 68.6% | (many diffs) |
| 5 | human | 130106 | CIB4 | calcium and integrin bindin... | XM_017003331.1 | 38.9% | 22.2% | (many diffs) |
| 6 | mouse | 73259 | Cib4 | calcium and integrin bindin... | NM_028483.1 | 87.7% | 91.8% | (many diffs) |
| 7 | mouse | 73259 | Cib4 | calcium and integrin bindin... | XM_006504153.2 | 63.4% | 65.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 624
- ORF length:
- 555
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggcaatgc ttgaggtatc agatgcactg ggaggacctg gaagagtacc 121 aggccctgac cttcctgacc agaaatgaaa ttctgtgcat ccatgacacc ttcctgaagc 181 tctgccctcc tgggaagtac tacaaggagg caacgctcac catggaccag gtcagctccc 241 tgccagctct gcgggtcaac cctttcagag accgtatctg cagagtgttc tcccacaaag 301 gcatgttctc cttTGAGGAT GTGCTGGGCA TGGCATCTGT GTTCAGCGAG CAGGCCTGCC 361 CAAGCCTGAA GATTGAGTAT GCCTTTCGCA TCTATGATTT TAATGAGAAT GGCTTCATTG 421 ATGAGGAGGA TCTGCAGAGG ATCATCCTGC GACTGCTGAA CAGTGATGAC ATGTCTGAGG 481 ACCTCCTGAT GGACCTCACG AACCACGTCC TGAGTGAGTC GGATCTGGAC AATGACAACA 541 TGCTGTCCTT CTCAGAGTTT GAACATGCAA TGGCCAAGTC TCCAGATTTC ATGAACTCCT 601 TTCGGATTCA CTTCTGGGGA TGCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 661 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 721 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC CGCATATCCT 781 AAATCCTAGT CGCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 841 att