Transcript: Mouse XM_006504153.2

PREDICTED: Mus musculus calcium and integrin binding family member 4 (Cib4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cib4 (73259)
Length:
733
CDS:
175..579

Additional Resources:

NCBI RefSeq record:
XM_006504153.2
NBCI Gene record:
Cib4 (73259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341606 ACCGCATCTGCAGGGTATTCT pLKO_005 224 CDS 100% 5.625 7.875 N Cib4 n/a
2 TRCN0000341534 TTAACGAGAATGGTTTCATTG pLKO_005 353 CDS 100% 10.800 8.640 N Cib4 n/a
3 TRCN0000341535 CTGACCTTCCTGACAAGAAAT pLKO_005 79 5UTR 100% 13.200 9.240 N Cib4 n/a
4 TRCN0000341537 GATCTGGACAATGACAGTATG pLKO_005 475 CDS 100% 10.800 7.560 N Cib4 n/a
5 TRCN0000341607 CCCTCGGGCAAGCACTATAAG pLKO_005 139 5UTR 100% 4.400 3.080 N Cib4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04858 pDONR223 100% 63.4% 65.9% None (many diffs) n/a
2 ccsbBroad304_04858 pLX_304 0% 63.4% 65.9% V5 (many diffs) n/a
3 TRCN0000475767 CCGCATATCCTAAATCCTAGTCGC pLX_317 55.5% 63.4% 65.9% V5 (many diffs) n/a
4 ccsbBroadEn_15241 pDONR223 100% 63.4% 65.9% None (many diffs) n/a
5 ccsbBroad304_15241 pLX_304 0% 63.4% 65.9% V5 (many diffs) n/a
6 TRCN0000471397 GTATAAGAGGAATCTAGTATCTCC pLX_317 64% 63.4% 65.9% V5 (many diffs) n/a
Download CSV