Transcript: Human XM_011532514.2

PREDICTED: Homo sapiens calcium and integrin binding family member 4 (CIB4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIB4 (130106)
Length:
853
CDS:
90..695

Additional Resources:

NCBI RefSeq record:
XM_011532514.2
NBCI Gene record:
CIB4 (130106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147449 GAGGTATCAGATGCACTGGG pXPR_003 AGG 23 4% 1 0.3796 CIB4 CIB4 75862
2 BRDN0001149378 TCCTTGTAGTACTTCCCAGG pXPR_003 AGG 171 28% 3 0.3454 CIB4 CIB4 75864
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360274 GTGAGTCGGATCTGGACAATG pLKO_005 583 CDS 100% 10.800 15.120 N CIB4 n/a
2 TRCN0000360207 CTGACCTTCCTGACCAGAAAT pLKO_005 195 CDS 100% 13.200 9.240 N CIB4 n/a
3 TRCN0000360273 ATGGCCAAGTCTCCAGATTTC pLKO_005 639 CDS 100% 10.800 7.560 N CIB4 n/a
4 TRCN0000052668 CCAGATTTCATGAACTCCTTT pLKO.1 651 CDS 100% 4.950 3.465 N CIB4 n/a
5 TRCN0000052669 CCCAAGCCTGAAGATTGAGTA pLKO.1 428 CDS 100% 4.950 3.465 N CIB4 n/a
6 TRCN0000367989 TGAGTATGCCTTTCGCATCTA pLKO_005 443 CDS 100% 4.950 3.465 N CIB4 n/a
7 TRCN0000052670 CAACCCTTTCAGAGACCGTAT pLKO.1 326 CDS 100% 4.050 2.835 N CIB4 n/a
8 TRCN0000052672 CAATGACAACATGCTGTCCTT pLKO.1 599 CDS 100% 2.640 1.848 N CIB4 n/a
9 TRCN0000052671 CAGAAATGAAATTCTGTGCAT pLKO.1 209 CDS 100% 0.264 0.185 N CIB4 n/a
10 TRCN0000174248 CAGAAATGAAATTCTGTGCAT pLKO.1 209 CDS 100% 0.264 0.185 N CIB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04858 pDONR223 100% 89.5% 81% None 0_1insATGGGGCA;44_99del n/a
2 ccsbBroad304_04858 pLX_304 0% 89.5% 81% V5 0_1insATGGGGCA;44_99del n/a
3 TRCN0000475767 CCGCATATCCTAAATCCTAGTCGC pLX_317 55.5% 89.5% 81% V5 0_1insATGGGGCA;44_99del n/a
4 ccsbBroadEn_15241 pDONR223 100% 89.5% 81% None 0_1insATGGGGCA;44_99del n/a
5 ccsbBroad304_15241 pLX_304 0% 89.5% 81% V5 0_1insATGGGGCA;44_99del n/a
6 TRCN0000471397 GTATAAGAGGAATCTAGTATCTCC pLX_317 64% 89.5% 81% V5 0_1insATGGGGCA;44_99del n/a
Download CSV