Construct: ORF TRCN0000475794
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004561.1_s317c1
- Derived from:
- ccsbBroadEn_10831
- DNA Barcode:
- GCAGACAGAAAGGTCGGGCGAGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FUT8 (2530)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475794
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371533.1 | 53.4% | 47.2% | (many diffs) |
| 2 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371534.1 | 53.4% | 47.2% | (many diffs) |
| 3 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_178155.3 | 53.4% | 47.2% | (many diffs) |
| 4 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_178156.2 | 53.4% | 47.2% | (many diffs) |
| 5 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371536.1 | 50.4% | 44.6% | (many diffs) |
| 6 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021136.1 | 50.4% | 44.6% | (many diffs) |
| 7 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021138.1 | 50.4% | 44.6% | (many diffs) |
| 8 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021139.1 | 50.4% | 44.6% | (many diffs) |
| 9 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021140.1 | 40% | 33.9% | (many diffs) |
| 10 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_004480.4 | 25.2% | 19.8% | 0_1ins489;347_770del;860_1236del |
| 11 | human | 2530 | FUT8 | fucosyltransferase 8 | NR_038167.1 | 19.3% | (many diffs) | |
| 12 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_001252614.1 | 49.8% | 46% | (many diffs) |
| 13 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_016893.5 | 49.8% | 46% | (many diffs) |
| 14 | mouse | 53618 | Fut8 | fucosyltransferase 8 | XM_011244144.2 | 49.8% | 46% | (many diffs) |
| 15 | mouse | 53618 | Fut8 | fucosyltransferase 8 | XM_011244145.2 | 49.8% | 46% | (many diffs) |
| 16 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NR_045554.1 | 25.7% | (many diffs) | |
| 17 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_001252615.1 | 23.6% | 19.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 993
- ORF length:
- 924
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcggccatgg actggttcct ggcgttggat tatgctcatt ctttttgcct 121 gggggacctt gctgttttat ataggtggtc acttggtacg agataatgac catcctgatc 181 actctagccg agaactgtcc aagattctgg caaagcttga acgcttaaaa cagcagaatg 241 aagacttgag gcgaatggcc gaatctctcc ggataccaga aggccctatt gatcaggggc 301 cagctatagg aagagtacgc gttttagaag agcagcttgt taaggccaaa gaacagattg 361 aaaattacaa gaaacagacc agaaatggtc tggggaagga tcatgaaatc ctgaggagga 421 ggattgaaaa tggagctaaa gagctctggt ttttcctaca gagtgaattg aagaaattaa 481 agaacttaga aggaaatgaa ctccaaagac atgcagatga atttcttttg gatttaggac 541 attatgaaag gtctataatg acggatctat actacctcag tcagacagat ggagcaggtg 601 attggcggga aaaagaggcc aaagatctga cagaactggt tcagcggaga ataacatatc 661 ttcagaatCC CAAGGACTGC AGCAAAGCCA AAAAGCTGGT GTGTAATATC AACAAAGGCT 721 GTGGCTATGG CTGTCAGCTC CATCATGTGG TCTACTGCTT CATGATTGCA TATGGCACCC 781 AGCGAACACT CATCTTGGAA TCTCAGAATT GGCGCTATGC TACTGGTGGA TGGGAGACTG 841 TATTTAGGCC TGTAAGTGAG ACATGCACAG ACAGATCTGG CATCTCCACT GGACACTGGT 901 CAGGTACCCC AATTATGAAT TTATTAGTGA TAACTCTATT TCCTGGTCAG CTGGACTGCA 961 CAATCGATAC ACAGAAAATT CACTTCGTGG AGTTGCCAAC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC 1141 AGACAGAAAG GTCGGGCGAG AAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt