Transcript: Human NM_001348994.2

Homo sapiens neurexophilin and PC-esterase domain family member 3 (NXPE3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-23
Taxon:
Homo sapiens (human)
Gene:
NXPE3 (91775)
Length:
8786
CDS:
830..2509

Additional Resources:

NCBI RefSeq record:
NM_001348994.2
NBCI Gene record:
NXPE3 (91775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308058 TCCGCTTCACGACTGTCTTTA pLKO_005 2064 CDS 100% 13.200 18.480 N NXPE3 n/a
2 TRCN0000296040 TGCATGCATAGCACAAGTAAT pLKO_005 2917 3UTR 100% 13.200 18.480 N NXPE3 n/a
3 TRCN0000116195 CAGCAGCAGAATTACCCATTT pLKO.1 1600 CDS 100% 10.800 15.120 N NXPE3 n/a
4 TRCN0000116193 GCAAAGTTAAAGTATCCGTAT pLKO.1 1365 CDS 100% 4.050 5.670 N NXPE3 n/a
5 TRCN0000296039 TAAACCAGACAGGGTCTATTT pLKO_005 1438 CDS 100% 13.200 10.560 N NXPE3 n/a
6 TRCN0000308029 TCCAGATTTAGTGGAGTTTAA pLKO_005 1954 CDS 100% 13.200 9.240 N NXPE3 n/a
7 TRCN0000116192 CGAGTTTAATTTGGGATCATT pLKO.1 3643 3UTR 100% 5.625 3.938 N NXPE3 n/a
8 TRCN0000116196 GATACCTGAAAGGTCTCCTAA pLKO.1 1629 CDS 100% 4.950 3.465 N NXPE3 n/a
9 TRCN0000116194 GCGAATGAGCTGAATGGCATT pLKO.1 2105 CDS 100% 4.050 2.835 N NXPE3 n/a
10 TRCN0000288931 GCGAATGAGCTGAATGGCATT pLKO_005 2105 CDS 100% 4.050 2.835 N NXPE3 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4068 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5255 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5255 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04561 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04561 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475967 GTGGCCAGCGACCTAGCGTTCGGT pLX_317 18.2% 100% 100% V5 n/a
Download CSV