Construct: ORF TRCN0000476095
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005901.1_s317c1
- Derived from:
- ccsbBroadEn_05056
- DNA Barcode:
- GTTAGCACAATAGATTAACGTTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGO1 (151648)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476095
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151648 | SGO1 | shugoshin 1 | NM_001199256.3 | 100% | 100% | |
| 2 | human | 151648 | SGO1 | shugoshin 1 | NM_138484.5 | 100% | 100% | |
| 3 | human | 151648 | SGO1 | shugoshin 1 | NM_001012412.5 | 94.4% | 94.4% | 474_524del |
| 4 | human | 151648 | SGO1 | shugoshin 1 | NM_001199254.3 | 94.4% | 94.4% | 474_524del |
| 5 | human | 151648 | SGO1 | shugoshin 1 | NM_001012413.3 | 88% | 86.3% | (many diffs) |
| 6 | human | 151648 | SGO1 | shugoshin 1 | NM_001199255.2 | 88% | 86.3% | (many diffs) |
| 7 | human | 151648 | SGO1 | shugoshin 1 | NM_001012411.3 | 83.1% | 81.5% | (many diffs) |
| 8 | human | 151648 | SGO1 | shugoshin 1 | NM_001199253.2 | 83.1% | 81.5% | (many diffs) |
| 9 | human | 151648 | SGO1 | shugoshin 1 | NM_001199257.3 | 72.4% | 68.8% | (many diffs) |
| 10 | human | 151648 | SGO1 | shugoshin 1 | NM_001012410.5 | 52% | 51.8% | 476_1282del |
| 11 | human | 151648 | SGO1 | shugoshin 1 | NM_001199252.3 | 52% | 51.8% | 476_1282del |
| 12 | human | 151648 | SGO1 | shugoshin 1 | XM_011533373.2 | 52% | 51.8% | 476_1282del |
| 13 | human | 151648 | SGO1 | shugoshin 1 | XM_011533375.2 | 52% | 51.8% | 476_1282del |
| 14 | human | 151648 | SGO1 | shugoshin 1 | XM_011533376.2 | 52% | 51.8% | 476_1282del |
| 15 | human | 151648 | SGO1 | shugoshin 1 | XM_011533377.2 | 52% | 51.8% | 476_1282del |
| 16 | human | 151648 | SGO1 | shugoshin 1 | NM_001012409.3 | 45.8% | 44.7% | (many diffs) |
| 17 | human | 151648 | SGO1 | shugoshin 1 | NM_001199251.3 | 45.8% | 44.7% | (many diffs) |
| 18 | human | 151648 | SGO1 | shugoshin 1 | NR_131180.1 | 28.4% | (many diffs) | |
| 19 | human | 151648 | SGO1 | shugoshin 1 | NR_131179.1 | 27.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 945
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccaaggaa agatgcctga aaaagtcctt tcaagatagt cttgaagaca 121 taaagaagcg aatgaaagag aaaaggaata aaaacttggc agagattggc aaacgcaggt 181 cttttatagc tgcaccatgc caaataatca ccaacacttc tacactgctg aaaaattacc 241 aagacaacaa caaaatgtta gttttagctt tggaaaatga aaaatccaaa gtgaaagaag 301 cccaagatat catcctacag ctgagaaaag aatgttacta tctcacatgt cagctatatg 361 cattgaaagg aaaacttaca tcacaacaaa cagtagaacc tgctcagaac caggaaatat 421 gttcctctgg aatggacccc aatagtgatg acagctccag aaatttattt gtgaaggatt 481 taccgcaaat tcctcttgaa gaaactgaac ttccaggaca aggagaatca tttcaaatag 541 aagctacacc acctgaaact cagcagtcac ctcatcttag cctgaaggat atcaccaatg 601 tctccttgta tcctgttgtg aaaaTCAGAA GACTTTCTCT TTCTCCAAAA AAGAATAAAG 661 CAAGCCCAGC AGTGGCTCTG CCTAAACGTA GGTGCACAGC CAGCGTGAAC TATAAGGAGC 721 CCACCCTCGC TTCGAAACTG AGAAGAGGGG ACCCTTTTAC AGATTTGTGT TTTTTGAATT 781 CTCCTATTTT CAAGCAGAAA AAGGATTTGA GACGTTCTAA AAAAAGAGCC CTGGAGGTAT 841 CACCTGCCAA AGAAGCAATT TTTATTTTAT ATTATGTTCG AGAATTTGTT TCGAGATTCC 901 CAGACTGTAG GAAATGTAAA CTTGAAACCC ACATCTGCTT GAGGTTGCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA GTTAGCACAA TAGATTAACG TTCAACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt