Transcript: Human XM_011533373.2

PREDICTED: Homo sapiens shugoshin 1 (SGO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGO1 (151648)
Length:
2129
CDS:
267..1952

Additional Resources:

NCBI RefSeq record:
XM_011533373.2
NBCI Gene record:
SGO1 (151648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426961 TGATTCCGATGACCTCTATTT pLKO_005 1394 CDS 100% 13.200 18.480 N SGO1 n/a
2 TRCN0000074152 CTAGAACTGTATCTGTTCGTA pLKO.1 823 CDS 100% 3.000 4.200 N SGO1 n/a
3 TRCN0000412541 GAAGATCAGATACCTACTATT pLKO_005 738 CDS 100% 13.200 10.560 N SGO1 n/a
4 TRCN0000432547 TGATTCAGCCAGGAACGTTTA pLKO_005 1042 CDS 100% 10.800 8.640 N SGO1 n/a
5 TRCN0000074148 CGGGCTTCACATCCTTAGAAA pLKO.1 1959 3UTR 100% 5.625 4.500 N SGO1 n/a
6 TRCN0000423315 ATAGCTGCACCATGCCAAATA pLKO_005 384 CDS 100% 13.200 9.240 N SGO1 n/a
7 TRCN0000417702 GTCACCAGGCCTCTAGCTAAA pLKO_005 1464 CDS 100% 10.800 7.560 N SGO1 n/a
8 TRCN0000074150 CCGCAAATTCCTCTTGAAGAA pLKO.1 681 CDS 100% 4.950 3.465 N SGO1 n/a
9 TRCN0000074151 CCTCATCTTAGCCTGAAGGAT pLKO.1 1575 CDS 100% 3.000 2.100 N SGO1 n/a
10 TRCN0000074149 CCACTAGTAAACATGCACATA pLKO.1 957 CDS 100% 0.000 0.000 N SGO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05056 pDONR223 100% 52% 51.8% None 476_1282del n/a
2 ccsbBroad304_05056 pLX_304 0% 52% 51.8% V5 476_1282del n/a
3 TRCN0000476095 GTTAGCACAATAGATTAACGTTCA pLX_317 36.8% 52% 51.8% V5 476_1282del n/a
Download CSV