Transcript: Human NM_138484.5

Homo sapiens shugoshin 1 (SGO1), transcript variant Sgo1L, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SGO1 (151648)
Length:
1546
CDS:
156..1034

Additional Resources:

NCBI RefSeq record:
NM_138484.5
NBCI Gene record:
SGO1 (151648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138484.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413324 TAATTAGAGATAGCAACTTTC pLKO_005 1196 3UTR 100% 10.800 15.120 N SGO1 n/a
2 TRCN0000074148 CGGGCTTCACATCCTTAGAAA pLKO.1 1041 3UTR 100% 5.625 4.500 N SGO1 n/a
3 TRCN0000423315 ATAGCTGCACCATGCCAAATA pLKO_005 273 CDS 100% 13.200 9.240 N SGO1 n/a
4 TRCN0000428386 GATATTGTGTAAGCGAAATTC pLKO_005 1397 3UTR 100% 13.200 9.240 N SGO1 n/a
5 TRCN0000074150 CCGCAAATTCCTCTTGAAGAA pLKO.1 570 CDS 100% 4.950 3.465 N SGO1 n/a
6 TRCN0000074151 CCTCATCTTAGCCTGAAGGAT pLKO.1 657 CDS 100% 3.000 2.100 N SGO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138484.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05056 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05056 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476095 GTTAGCACAATAGATTAACGTTCA pLX_317 36.8% 100% 100% V5 n/a
Download CSV