Construct: ORF TRCN0000476111
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009337.1_s317c1
- Derived from:
- ccsbBroadEn_01636
- DNA Barcode:
- TTTCCCACTTCGTTATAGAGTCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TACR1 (6869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476111
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6869 | TACR1 | tachykinin receptor 1 | NM_001058.4 | 100% | 100% | |
| 2 | human | 6869 | TACR1 | tachykinin receptor 1 | NM_015727.3 | 76.4% | 76.4% | 933_934ins288 |
| 3 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | NM_009313.5 | 89.7% | 94.5% | (many diffs) |
| 4 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505863.3 | 89.7% | 94.5% | (many diffs) |
| 5 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505864.3 | 89.7% | 94.5% | (many diffs) |
| 6 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505865.3 | 89.7% | 94.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1290
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggataacgtc ctcccggtgg actcagacct ctccccaaac atctccacta 121 acacctcgga acccaatcag ttcgtgcaac cagcctggca aattgtcctt tgggcagctg 181 cctacacggt cattgtggtg acctctgtgg tgggcaacgt ggtagtgatg tggatcatct 241 tagcccacaa aagaatgagg acagtgacga actattttct ggtgaacctg gccttcgcgg 301 aggcctccat ggctgcattc aatacagtgg tgaacttcac ctatgctgtc cacaacgaat 361 ggtactacgg cctgttctac tgcaagttcc acaacttctt tcccatcgcc gctgtcttcg 421 ccagtatcta ctccatgacg gctgtggcct ttgataggta catggccatc atacatcccc 481 tccagccccg gctgtcagcc acagccacca aagtggtcat ctgtgtcatc tgggtcctgg 541 ctctcctgct ggccttcccc cagggctact actcaaccac agagaccatg cccagcagag 601 tcgtgtgcat gatcgaatgg ccagagcatc cgaacaagat ttatgagaaa gtgtaccaca 661 tctgtgtgac tgtgctgatc tacttcctcc ccctgctggt gattggctat gcatacaccg 721 tagtgggaat cacactatgg gccagtgaga tccccgggga ctcctctgac cgctaccacg 781 agcaagtctc tgccaagcgc aaggtggtca aaatgatgat tgtcgtggtg tgcaccttcg 841 ccatctgctg gctgcccttc cacatcttct tcctcctgcc ctacatcaac ccagatctct 901 acctgaagaa gtttatccag caggtctacc tggccatcat gtggctggcc atgagctcca 961 ccatgtacaa ccccatcatc tactgctgcc tcaatgacag gttccgtctg ggcttcaagc 1021 atgccttccg gtgctgcccc ttcatcagcg ccggcgacta tgaggggctg gaaatgaaat 1081 CCACCCGGTA TCTCCAGACC CAGGGCAGTG TGTACAAAGT CAGCCGCCTG GAGACCACCA 1141 TCTCCACAGT GGTGGGGGCC CACGAGGAGG AGCCAGAGGA CGGCCCCAAG GCCACACCCT 1201 CGTCCCTGGA CCTGACCTCC AACTGCTCTT CACGAAGTGA CTCCAAGACC ATGACAGAGA 1261 GCTTCAGCTT CTCCTCCAAT GTGCTCTCCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1321 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1381 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATTTCC 1441 CACTTCGTTA TAGAGTCACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1501 tgaaagatt