Transcript: Human NM_015727.3

Homo sapiens tachykinin receptor 1 (TACR1), transcript variant short, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
TACR1 (6869)
Length:
1733
CDS:
587..1522

Additional Resources:

NCBI RefSeq record:
NM_015727.3
NBCI Gene record:
TACR1 (6869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015727.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358179 GAGGACAGTGACGAACTATTT pLKO_005 775 CDS 100% 13.200 9.240 N TACR1 n/a
2 TRCN0000013990 CCCAGATCTCTACCTGAAGAA pLKO.1 1408 CDS 100% 4.950 3.465 N TACR1 n/a
3 TRCN0000013989 CCGAACAAGATTTATGAGAAA pLKO.1 1148 CDS 100% 4.950 3.465 N TACR1 n/a
4 TRCN0000013991 CGTGGTAGTGATGTGGATCAT pLKO.1 736 CDS 100% 4.950 3.465 N TACR1 n/a
5 TRCN0000358177 ATAGGTACATGGCCATCATAC pLKO_005 972 CDS 100% 10.800 6.480 N TACR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015727.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487899 ACCAGCACTGGCACATTGAGCGCA pLX_317 27.5% 99.8% 100% V5 (not translated due to prior stop codon) 333T>C n/a
2 TRCN0000491956 ATCGTGATTCGGGCGAAATCGTGC pLX_317 46.5% 99.7% 99.6% V5 333T>C;933_934insG n/a
3 ccsbBroadEn_01636 pDONR223 100% 76.4% 76.4% None 933_934ins288 n/a
4 ccsbBroad304_01636 pLX_304 0% 76.4% 76.4% V5 933_934ins288 n/a
5 TRCN0000476111 TTTCCCACTTCGTTATAGAGTCAC pLX_317 17.6% 76.4% 76.4% V5 933_934ins288 n/a
6 TRCN0000488779 TTTCCCCCTTCTGGGGAATTGCCT pLX_317 29.6% 76.4% 76.4% V5 933_934ins288 n/a
7 TRCN0000488891 TCAATCAATGTTTTATCATTTTTA pLX_317 26.2% 76.4% 76.4% V5 (not translated due to prior stop codon) 933_934ins288 n/a
Download CSV