Transcript: Mouse NM_009313.5

Mus musculus tachykinin receptor 1 (Tacr1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Tacr1 (21336)
Length:
5036
CDS:
917..2140

Additional Resources:

NCBI RefSeq record:
NM_009313.5
NBCI Gene record:
Tacr1 (21336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009313.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240665 GAGGACAGTGACCAATTATTT pLKO_005 1105 CDS 100% 15.000 10.500 N Tacr1 n/a
2 TRCN0000240666 TGGAGAAGGCAAGCGTTATAT pLKO_005 3835 3UTR 100% 15.000 10.500 N Tacr1 n/a
3 TRCN0000240667 TAGTGGTGATATGGATCATTT pLKO_005 1068 CDS 100% 13.200 9.240 N Tacr1 n/a
4 TRCN0000240663 CATACACTGTGGTAGGGATTA pLKO_005 1560 CDS 100% 10.800 7.560 N Tacr1 n/a
5 TRCN0000240664 CCAACAGGACTTACGAGAAAG pLKO_005 1479 CDS 100% 10.800 7.560 N Tacr1 n/a
6 TRCN0000173524 GCTACCAAAGTGGTCATCTTT pLKO.1 1352 CDS 100% 5.625 3.938 N Tacr1 n/a
7 TRCN0000173428 CTAACCAGTTTGTGCAACCTA pLKO.1 981 CDS 100% 3.000 2.100 N Tacr1 n/a
8 TRCN0000193096 CTGCAAGTTTCACAACTTCTT pLKO.1 1228 CDS 100% 0.495 0.347 N Tacr1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3081 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009313.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01636 pDONR223 100% 89.7% 94.5% None (many diffs) n/a
2 ccsbBroad304_01636 pLX_304 0% 89.7% 94.5% V5 (many diffs) n/a
3 TRCN0000476111 TTTCCCACTTCGTTATAGAGTCAC pLX_317 17.6% 89.7% 94.5% V5 (many diffs) n/a
4 TRCN0000488779 TTTCCCCCTTCTGGGGAATTGCCT pLX_317 29.6% 89.7% 94.5% V5 (many diffs) n/a
5 TRCN0000488891 TCAATCAATGTTTTATCATTTTTA pLX_317 26.2% 89.7% 94.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491956 ATCGTGATTCGGGCGAAATCGTGC pLX_317 46.5% 69.4% 73.2% V5 (many diffs) n/a
7 TRCN0000487899 ACCAGCACTGGCACATTGAGCGCA pLX_317 27.5% 69.4% 73.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV