Construct: ORF TRCN0000476124
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005509.1_s317c1
- Derived from:
- ccsbBroadEn_08669
- DNA Barcode:
- CTACGCGCCACTCAGTCGTTCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PMEPA1 (56937)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476124
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199169.3 | 99.6% | 99.6% | 118C>T;336A>G;354A>G |
| 2 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_001255976.2 | 96.9% | 96.5% | (many diffs) |
| 3 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199170.3 | 93.6% | 93.6% | (many diffs) |
| 4 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199171.2 | 93.6% | 93.6% | (many diffs) |
| 5 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_020182.5 | 87.4% | 86.7% | (many diffs) |
| 6 | mouse | 65112 | Pmepa1 | prostate transmembrane prot... | NM_022995.3 | 74.9% | 78% | (many diffs) |
| 7 | mouse | 65112 | Pmepa1 | prostate transmembrane prot... | XM_006499991.3 | 65.6% | 69.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 825
- ORF length:
- 756
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggagctg gagtttgttc agatcatcat catcgtggtg gtgatgatgg 121 tgatggtggt ggtgatcacg tgcctgctga gccactacaa gctgtctgca cggtccttca 181 tcagctggca cagccagggg cggaggagag aagatgccct gtcctcagaa ggatgcctgt 241 ggccctcgga gagcacagtg tcaggcaacg gaatcccaga gccgcaggtc tacgccccgc 301 ctcggcccac cgaccgcctg gccgtgccgc ccttcgccca gcgggagcgc ttccaccgct 361 tccagcccac ctatccgtac ctgcagcacg agatcgacct gccgcccacc atctcgctgt 421 cggacgggga ggagccccca ccctaccagg gcccctgcac cctccagctt cgggaccccg 481 agcagcagct ggaacTGAAC CGGGAGTCGG TGCGCGCACC CCCAAACAGA ACCATCTTCG 541 ACAGTGACCT GATGGATAGT GCCAGGCTGG GCGGCCCCTG CCCCCCCAGC AGTAACTCGG 601 GCATCAGCGC CACGTGCTAC GGCAGCGGCG GGCGCATGGA GGGGCCGCCG CCCACCTACA 661 GCGAGGTCAT CGGCCACTAC CCGGGGTCCT CCTTCCAGCA CCAGCAGAGC AGTGGGCCGC 721 CCTCCTTGCT GGAGGGGACC CGGCTCCACC ACACACACAT CGCGCCCCTA GAGAGCGCAG 781 CCATCTGGAG CAAAGAGAAG GATAAACAGA AAGGACACCC TCTCTTGCCA ACTTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA CTACGCGCCA CTCAGTCGTT CACTACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt