Construct: ORF TRCN0000476133
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011715.1_s317c1
- Derived from:
- ccsbBroadEn_11366
- DNA Barcode:
- AGGACCCCAACACACTTATCGGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FADS2 (9415)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476133
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9415 | FADS2 | fatty acid desaturase 2 | NM_004265.4 | 86.8% | 86.7% | 1158_1332delinsG |
| 2 | human | 9415 | FADS2 | fatty acid desaturase 2 | NM_001281501.1 | 77.4% | 71% | (many diffs) |
| 3 | human | 9415 | FADS2 | fatty acid desaturase 2 | NM_001281502.1 | 75.6% | 69.6% | (many diffs) |
| 4 | mouse | 56473 | Fads2 | fatty acid desaturase 2 | NM_019699.1 | 75.8% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1224
- ORF length:
- 1158
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaagggaggg aaccagggcg agggggccgc cgagcgcgag gtgtcggtgc 121 ccaccttcag ctgggaggag attcagaagc ataacctgcg caccgacagg tggctggtca 181 ttgaccgcaa ggtttacaac atcaccaaat ggtccatcca gcacccgggg ggccagcggg 241 tcatcgggca ctacgctgga gaagatgcaa cggatgcctt ccgcgccttc caccctgacc 301 tggaattcgt gggcaagttc ttgaaacccc tgctgattgg tgaactggcc ccggaggagc 361 ccagccagga ccacggcaag aactcaaaga tcactgagga cttccgggcc ctgaggaaga 421 cggctgagga catgaacctg ttcaagacca accacgtgtt cttcctcctc ctcctggccc 481 acatcatcgc cctggagagc attgcatggt tcactgtctt ttactttggc aatggctgga 541 ttcctaccct catcacggcc tttgtccttg ctacctctca ggcccaagct ggatggctgc 601 aacatgatta tggccacctg tctgtctaca gaaaacccaa gtggaaccac cttgtccaca 661 aattcgtcat tggccactta aagggtgcct ctgccaactg gtggaatcat cgccacttcc 721 agcaccacgc caagcctaac atcttccaca aggatcccga tgtgaacatg ctgcacgtgt 781 ttgttctggg cgaatggcag cccatcgagt acggcaagaa gaagctgaaa tacctgccct 841 acaatcacca gcacgaatac ttcttcctga ttgggccgcc gctgctcatc cccatgtatt 901 tccagtacca gatcatcatg accatgatcg tccataagaa ctgggtggac ctggcctggg 961 ccgtcagcta ctacatccgg ttcttcatca cctacatccc tttcTACGGC ATCCTGGGAG 1021 CCCTCCTTTT CCTCAACTTC ATCAGGTTCC TGGAGAGCCA CTGGTTTGTG TGGGTCACAC 1081 AGATGAATCA CATCGTCATG GAGATTGACC AGGAGGCCTA CCGTGACTGG TTCAGTAGCC 1141 AGCTGACAGC CACCTGCAAC GTGGAGCAGT CCTTCTTCAA CGACTGGTTC AGTGGACACC 1201 TTAACTTCCA GATTGAGCAC CAGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1261 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1321 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA GGACCCCAAC 1381 ACACTTATCG GCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1441 att