Transcript: Mouse NM_019699.1

Mus musculus fatty acid desaturase 2 (Fads2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fads2 (56473)
Length:
1508
CDS:
75..1409

Additional Resources:

NCBI RefSeq record:
NM_019699.1
NBCI Gene record:
Fads2 (56473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338083 TCCACAAGGACCCGGACATAA pLKO_005 754 CDS 100% 13.200 18.480 N Fads2 n/a
2 TRCN0000114338 CACCTTTCTGTCTATAAGAAA pLKO.1 624 CDS 100% 0.563 0.788 N Fads2 n/a
3 TRCN0000338081 CACCTTTCTGTCTATAAGAAA pLKO_005 624 CDS 100% 0.563 0.788 N Fads2 n/a
4 TRCN0000114336 CCCACATCATCGTCATGGAAA pLKO.1 487 CDS 100% 4.950 3.465 N Fads2 n/a
5 TRCN0000338080 CCCACATCATCGTCATGGAAA pLKO_005 487 CDS 100% 4.950 3.465 N Fads2 n/a
6 TRCN0000114337 GCGTTTCTTCTACACCTACAT pLKO.1 986 CDS 100% 4.950 3.465 N Fads2 n/a
7 TRCN0000338082 GCGTTTCTTCTACACCTACAT pLKO_005 986 CDS 100% 4.950 3.465 N Fads2 n/a
8 TRCN0000114340 GAAGCTGAAATACCTGCCCTA pLKO.1 830 CDS 100% 2.160 1.512 N Fads2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491819 GTTAAGTTCGACAGAAATATTGGT pLX_317 26.3% 87.1% 87.4% V5 (many diffs) n/a
2 ccsbBroadEn_11366 pDONR223 100% 75.8% 75.2% None (many diffs) n/a
3 ccsbBroad304_11366 pLX_304 0% 75.8% 75.2% V5 (many diffs) n/a
4 TRCN0000476133 AGGACCCCAACACACTTATCGGCG pLX_317 19.5% 75.8% 75.2% V5 (many diffs) n/a
Download CSV