Construct: ORF TRCN0000476205
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001378.1_s317c1
- Derived from:
- ccsbBroadEn_14167
- DNA Barcode:
- ACACAACCAGGCTCCGGTTGCAGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- TBC1D13 (54662)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476205
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54662 | TBC1D13 | TBC1 domain family member 13 | NM_018201.5 | 99.8% | 1.4% | 6delA;1029C>T |
| 2 | human | 54662 | TBC1D13 | TBC1 domain family member 13 | XM_005252060.2 | 80.9% | 1.8% | 0_1ins227;801C>T |
| 3 | human | 54662 | TBC1D13 | TBC1 domain family member 13 | NM_001286772.1 | 68.5% | 2.1% | 6delA;543_544ins375;654C>T |
| 4 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | NM_146252.3 | 90.4% | 1.4% | (many diffs) |
| 5 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_006498320.2 | 73.1% | 1.8% | (many diffs) |
| 6 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_006498321.2 | 73.1% | 1.8% | (many diffs) |
| 7 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_006498322.2 | 73.1% | 1.8% | (many diffs) |
| 8 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_017319254.1 | 73.1% | 1.8% | (many diffs) |
| 9 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_006498323.3 | 51.5% | 2.5% | (many diffs) |
| 10 | mouse | 70296 | Tbc1d13 | TBC1 domain family, member 13 | XM_006498324.2 | 49.8% | 2.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 114
- ORF length:
- 45
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcagtctgc acaagagccg aattgcagat ttccaggatg tcctgaagga 121 gccctcaatt gcattggaaa agctgcggga actcagcttt agtggcatcc cctgtgaggg 181 cggactgcgg tgcctctgct ggaagattct cttgaactac cttcccttgg agagagcctc 241 atggacctcc atcctggcca agcagaggga gctgtatgcc cagttcctga gggaaatgat 301 catccagcct ggcattgcca aggccaacat gggtgtgtcc agggaggatg tgacttttga 361 ggaccatcca ctcaacccca accctgacag ccggtggaac acgtacttca aggacaacga 421 ggtgctgctg cagatcgaca aagatgtccg gaggttgtgc ccagacattt ccttcttcca 481 gagggccact gactaccctt gcctcctcat cctggacccc cagaatgagt ttgaaaccct 541 tcgtaagaga gtggaacaga caacactgaa atctcagacg gtggcccgga accggagtgg 601 ggtcacaaat atgagctccc cacacaagaa ctctgtgcca tcatccctaa atgagtatga 661 ggtgctgccc aatggctgtg aggcccactg ggaggtggtg gagcggatcc tgttcatcta 721 cgccaagctc aaccctggca tcgcttatgt gcaaggcatg aatgaaatcg tggggcccct 781 ctactacacc tttgccaccg accccaatag tgagtggaaa gagcacgccg aggcagacac 841 ctttttctgc ttcaccaacc tcatggccga gatccgggac aactttatca agagcctgga 901 tgactcgcag tgtggcatca ccTACAAGAT GGAGAAGGTT TACTCCACCT TGAAAGATAA 961 GGATGTGGAG CTCTACCTGA AACTGCAAGA GCAGAACATC AAGCCTCAGT TCTTTGCCTT 1021 CCGCTGGCTG ACACTGCTGC TGTCCCAGGA GTTCTTGCTG CCTGACGTCA TCCGCATCTG 1081 GGACTCCCTC TTCGCTGATG ACAACCGCTT TGACTTCCTC CTCCTCGTCT GCTGCGCCAT 1141 GCTCATGCTG ATCCGGGAGC AGTTGCTGGA AGGGGACTTC ACTGTGAATA TGCGGCTGCT 1201 GCAGGACTAC CCCATCACAG ATGTCTGCCA GATCCTGCAG AAAGCCAAGG AGCTCCAAGA 1261 CTCAAAGTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 1321 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 1381 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAACACAAC CAGGCTCCGG TTGCAGGACG 1441 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt