Transcript: Mouse XM_017319254.1

PREDICTED: Mus musculus TBC1 domain family, member 13 (Tbc1d13), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d13 (70296)
Length:
3693
CDS:
472..1446

Additional Resources:

NCBI RefSeq record:
XM_017319254.1
NBCI Gene record:
Tbc1d13 (70296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257953 TTACCCTAGAGCCGAGTATAA pLKO_005 3226 3UTR 100% 13.200 18.480 N Tbc1d13 n/a
2 TRCN0000183468 GCTTGATCTATCTTCTGACTT pLKO.1 2747 3UTR 100% 4.950 6.930 N Tbc1d13 n/a
3 TRCN0000249814 TGATGGCAACCGATTCGATTT pLKO_005 1272 CDS 100% 10.800 8.640 N Tbc1d13 n/a
4 TRCN0000249812 GGAGGTTGTGCCCAGATATAT pLKO_005 626 CDS 100% 15.000 10.500 N Tbc1d13 n/a
5 TRCN0000216876 GTTCCTGAGAGAGATGATTAT pLKO.1 459 5UTR 100% 13.200 9.240 N Tbc1d13 n/a
6 TRCN0000257964 AGCGCATCCTGTTCATCTATG pLKO_005 878 CDS 100% 10.800 7.560 N Tbc1d13 n/a
7 TRCN0000249813 CATCAGCCCTGAACGAGTATG pLKO_005 815 CDS 100% 10.800 7.560 N Tbc1d13 n/a
8 TRCN0000179787 GAGTATCAAGCCTCAGTTCTT pLKO.1 1170 CDS 100% 4.950 3.465 N Tbc1d13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14167 pDONR223 100% 73.1% 1.8% None (many diffs) n/a
2 ccsbBroad304_14167 pLX_304 0% 73.1% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476205 ACACAACCAGGCTCCGGTTGCAGG pLX_317 29.1% 73.1% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15867 pDONR223 0% 73% 79.5% None (many diffs) n/a
5 ccsbBroad304_15867 pLX_304 0% 73% 79.5% V5 (many diffs) n/a
6 TRCN0000475660 TCTACATAGTCTGGTTCCCGAGGG pLX_317 29.1% 73% 79.5% V5 (many diffs) n/a
Download CSV