Transcript: Human NM_001286772.1

Homo sapiens TBC1 domain family member 13 (TBC1D13), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-10-09
Taxon:
Homo sapiens (human)
Gene:
TBC1D13 (54662)
Length:
3544
CDS:
148..975

Additional Resources:

NCBI RefSeq record:
NM_001286772.1
NBCI Gene record:
TBC1D13 (54662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138497 CGATGACAACCGCTTTGACTT pLKO.1 801 CDS 100% 4.950 6.930 N TBC1D13 n/a
2 TRCN0000437278 GTCCTGAAGGAGCCCTCAATT pLKO_005 190 CDS 100% 13.200 10.560 N TBC1D13 n/a
3 TRCN0000431731 GAGTTTGAAACCCTTCGTAAG pLKO_005 607 CDS 100% 6.000 4.200 N TBC1D13 n/a
4 TRCN0000135970 GCACAGTATTTGGGAGACTTT pLKO.1 2658 3UTR 100% 4.950 3.465 N TBC1D13 n/a
5 TRCN0000135396 GAACACGTACTTCAAGGACAA pLKO.1 477 CDS 100% 4.050 2.835 N TBC1D13 n/a
6 TRCN0000135840 CCACACTACTTGAATCACCAT pLKO.1 3120 3UTR 100% 2.640 1.848 N TBC1D13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15867 pDONR223 0% 68.7% 68.7% None 543_544ins375 n/a
2 ccsbBroad304_15867 pLX_304 0% 68.7% 68.7% V5 543_544ins375 n/a
3 TRCN0000475660 TCTACATAGTCTGGTTCCCGAGGG pLX_317 29.1% 68.7% 68.7% V5 543_544ins375 n/a
4 ccsbBroadEn_14167 pDONR223 100% 68.5% 2.1% None 6delA;543_544ins375;654C>T n/a
5 ccsbBroad304_14167 pLX_304 0% 68.5% 2.1% V5 (not translated due to prior stop codon) 6delA;543_544ins375;654C>T n/a
6 TRCN0000476205 ACACAACCAGGCTCCGGTTGCAGG pLX_317 29.1% 68.5% 2.1% V5 (not translated due to prior stop codon) 6delA;543_544ins375;654C>T n/a
Download CSV