Construct: ORF TRCN0000476235
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014179.1_s317c1
- Derived from:
- ccsbBroadEn_06247
- DNA Barcode:
- AATCTGTATAATGTTTGGAAGTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GABRP (2568)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476235
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2568 | GABRP | gamma-aminobutyric acid typ... | NM_014211.3 | 99.9% | 99.7% | 186G>T |
| 2 | human | 2568 | GABRP | gamma-aminobutyric acid typ... | XM_024446012.1 | 99.9% | 99.7% | 186G>T |
| 3 | human | 2568 | GABRP | gamma-aminobutyric acid typ... | XM_005265872.2 | 82% | 82% | 0_1ins237 |
| 4 | human | 2568 | GABRP | gamma-aminobutyric acid typ... | NM_001291985.1 | 65.6% | 63.8% | 186G>T;831_832ins188;867_868ins265 |
| 5 | mouse | 216643 | Gabrp | gamma-aminobutyric acid (GA... | NM_146017.3 | 88.7% | 92.7% | (many diffs) |
| 6 | mouse | 216643 | Gabrp | gamma-aminobutyric acid (GA... | XM_006514666.3 | 73% | 77.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1389
- ORF length:
- 1320
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaactacagc ctccacttgg ccttcgtgtg tctgagtctc ttcactgaga 121 ggatgtgcat ccaggggagt cagttcaacg tcgaggtcgg cagaagtgac aagctttccc 181 tgcctggctt tgagaacctc acagcaggat ataacaaatt tctcaggccc aattttggtg 241 gagaacccgt acatatagcg ctgactctgg acattgcaag tatctctagc atttcagaga 301 gtaacatgga ctacacagcc accatatacc tccgacagcg ctggatggac cagcggctgg 361 tgtttgaagg caacaagagc ttcactctgg atgcccgcct cgtggagttc ctctgggtgc 421 cagatactta cattgtggag tccaagaagt ccttcctcca tgaagtcact gtgggaaaca 481 ggctcatccg cctcttctcc aatggcacgg tcctgtatgc cctcagaatc acgacaactg 541 ttgcatgtaa catggatctg tctaaatacc ccatggacac acagacatgc aagttgcagc 601 tggaaagctg gggctatgat ggaaatgatg tggagttcac ctggctgaga gggaacgact 661 ctgtgcgtgg actggaacac ctgcggcttg ctcagtacac catagagcgg tatttcacct 721 tagtcaccag atcgcagcag gagacaggaa attacactag attggtctta cagtttgagc 781 ttcggaggaa tgttctgtat ttcattttgg aaacctacgt tccttccact ttcctggtgg 841 tgttgtcctg ggtttcattt tggatctctc tcgattcagt ccctgcaaga acctgcattg 901 gagtgacgac cgtgttatca atgaccacac tgatgatcgg gtcccgcact tctcttccca 961 acaccaactg cttcatcaag gccatcgatg tgtacctggg gatctgcttt agctttgtgt 1021 ttGGGGCCTT GCTAGAATAT GCAGTTGCTC ACTACAGTTC CTTACAGCAG ATGGCAGCCA 1081 AAGATAGGGG GACAACAAAG GAAGTAGAAG AAGTCAGTAT TACTAATATC ATCAACAGCT 1141 CCATCTCCAG CTTTAAACGG AAGATCAGCT TTGCCAGCAT TGAAATTTCC AGCGACAACG 1201 TTGACTACAG TGACTTGACA ATGAAAACCA GCGACAAGTT CAAGTTTGTC TTCCGAGAAA 1261 AGATGGGCAG GATTGTTGAT TATTTCACAA TTCAAAACCC CAGTAATGTT GATCACTATT 1321 CCAAACTACT GTTTCCTTTG ATTTTTATGC TAGCCAATGT ATTTTACTGG GCATACTACA 1381 TGTATTTTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1441 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1501 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAATCTG TATAATGTTT GGAAGTTCAC 1561 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt