Transcript: Human NM_014211.3

Homo sapiens gamma-aminobutyric acid type A receptor pi subunit (GABRP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GABRP (2568)
Length:
3304
CDS:
193..1515

Additional Resources:

NCBI RefSeq record:
NM_014211.3
NBCI Gene record:
GABRP (2568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063096 CCAGTAATGTTGATCACTATT pLKO.1 1424 CDS 100% 13.200 18.480 N GABRP n/a
2 TRCN0000420066 TTGGAGTGACGACCGTGTTAT pLKO_005 1022 CDS 100% 13.200 18.480 N GABRP n/a
3 TRCN0000439773 TAGCGCTGACTCTGGACATTG pLKO_005 380 CDS 100% 10.800 8.640 N GABRP n/a
4 TRCN0000063094 GACAGGAAATTACACTAGATT pLKO.1 867 CDS 100% 5.625 4.500 N GABRP n/a
5 TRCN0000063093 GCCTTGCTAGAATATGCAGTT pLKO.1 1150 CDS 100% 4.050 3.240 N GABRP n/a
6 TRCN0000430180 GTACACCATAGAGCGGTATTT pLKO_005 819 CDS 100% 13.200 9.240 N GABRP n/a
7 TRCN0000063095 CTCTAGCATTTCAGAGAGTAA pLKO.1 408 CDS 100% 4.950 3.465 N GABRP n/a
8 TRCN0000063097 CGACAAGTTCAAGTTTGTCTT pLKO.1 1356 CDS 100% 0.495 0.347 N GABRP n/a
9 TRCN0000430714 GTGTAGAAGTCCTAGCATTAT pLKO_005 1684 3UTR 100% 13.200 7.920 N GABRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06247 pDONR223 100% 99.9% 99.7% None 186G>T n/a
2 ccsbBroad304_06247 pLX_304 0% 99.9% 99.7% V5 186G>T n/a
3 TRCN0000476235 AATCTGTATAATGTTTGGAAGTTC pLX_317 28% 99.9% 99.7% V5 186G>T n/a
Download CSV