Transcript: Mouse NM_146017.3

Mus musculus gamma-aminobutyric acid (GABA) A receptor, pi (Gabrp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gabrp (216643)
Length:
3280
CDS:
199..1521

Additional Resources:

NCBI RefSeq record:
NM_146017.3
NBCI Gene record:
Gabrp (216643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103051 GCCAGCGACAAGTTTAAGTTT pLKO.1 1357 CDS 100% 5.625 4.500 N Gabrp n/a
2 TRCN0000103054 CGATACTCCAAACTACTATTT pLKO.1 1444 CDS 100% 13.200 9.240 N Gabrp n/a
3 TRCN0000103050 GCGTCAATTCATTGGTGGTTA pLKO.1 1967 3UTR 100% 4.950 3.465 N Gabrp n/a
4 TRCN0000103052 CCATGAAGTCACAGTGGGAAA pLKO.1 588 CDS 100% 4.050 2.835 N Gabrp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06247 pDONR223 100% 88.7% 92.7% None (many diffs) n/a
2 ccsbBroad304_06247 pLX_304 0% 88.7% 92.7% V5 (many diffs) n/a
3 TRCN0000476235 AATCTGTATAATGTTTGGAAGTTC pLX_317 28% 88.7% 92.7% V5 (many diffs) n/a
Download CSV