Construct: ORF TRCN0000476286
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016520.1_s317c1
- Derived from:
- ccsbBroadEn_03137
- DNA Barcode:
- TTTTTTGGCACAAAAAACATGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNIP1 (30820)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476286
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | NM_014592.4 | 100% | 100% | |
2 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | NM_001034837.3 | 95.1% | 95.1% | 60_92del |
3 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | NM_001034838.3 | 90.3% | 85.1% | (many diffs) |
4 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | XM_017009407.1 | 90.3% | 85.1% | (many diffs) |
5 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | NM_001278339.2 | 89.6% | 89.6% | 255_329del |
6 | human | 30820 | KCNIP1 | potassium voltage-gated cha... | NM_001278340.2 | 87% | 87% | 0_1ins84 |
7 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | NM_027398.3 | 91.5% | 99.5% | (many diffs) |
8 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_017314754.1 | 89.8% | 97.7% | (many diffs) |
9 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | NM_001190885.1 | 87% | 94.7% | (many diffs) |
10 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_017314752.1 | 85.5% | 93% | (many diffs) |
11 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | NM_001190886.1 | 84% | 84.6% | (many diffs) |
12 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_017314753.1 | 82.5% | 83.2% | (many diffs) |
13 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | NM_001290690.1 | 79.7% | 86.5% | (many diffs) |
14 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_006514803.3 | 79% | 82% | (many diffs) |
15 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_017314755.1 | 78.3% | 85% | (many diffs) |
16 | mouse | 70357 | Kcnip1 | Kv channel-interacting prot... | XM_017314751.1 | 77.8% | 80.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 717
- ORF length:
- 648
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggggccgtc atgggcacct tctcatctct gcaaaccaaa caaaggcgac 121 cctcgaaaga taagattgaa gatgagctgg agatgaccat ggtttgccat cggcccgagg 181 gactggagca gctcgaggcc cagaccaact tcaccaagag ggagctgcag gtcctttatc 241 gaggcttcaa aaatgagtgc cccagtggtg tggtcaacga agacacattc aagcagatct 301 atgctcagtt tttccctcat ggagatgcca gcacgtatgc ccattacctc ttcaatgcct 361 tcgacaccac TCAGACAGGC TCCGTGAAGT TCGAGGACTT TGTAACCGCT CTGTCGATTT 421 TATTGAGAGG AACTGTCCAC GAGAAACTAA GGTGGACATT TAATTTGTAT GACATCAACA 481 AGGACGGATA CATAAACAAA GAGGAGATGA TGGACATTGT CAAAGCCATC TATGACATGA 541 TGGGGAAATA CACATATCCT GTGCTCAAAG AGGACACTCC AAGGCAGCAT GTGGACGTCT 601 TCTTCCAGAA AATGGACAAA AATAAAGATG GCATCGTAAC TTTAGATGAA TTTCTTGAAT 661 CATGTCAGGA GGACGACAAC ATCATGAGGT CTCTCCAGCT GTTTCAAAAT GTCATGTTGC 721 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 781 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 841 ATATATCTTG TGGAAAGGAC GATTTTTTGG CACAAAAAAC ATGGGTACGC GTTAAGTCga 901 caatcaacct ctggattaca aaatttgtga aagatt