Transcript: Mouse NM_001190885.1

Mus musculus Kv channel-interacting protein 1 (Kcnip1), transcript variant A, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kcnip1 (70357)
Length:
2291
CDS:
396..1079

Additional Resources:

NCBI RefSeq record:
NM_001190885.1
NBCI Gene record:
Kcnip1 (70357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426157 ACTAAGGTGGACGTTTAATTT pLKO_005 806 CDS 100% 15.000 21.000 N Kcnip1 n/a
2 TRCN0000069700 GATGGCATTGTAACGTTAGAT pLKO.1 987 CDS 100% 5.625 7.875 N Kcnip1 n/a
3 TRCN0000428370 CACGGAGATGCCAGCACATAT pLKO_005 678 CDS 100% 13.200 10.560 N Kcnip1 n/a
4 TRCN0000069702 CTACATAAACAAAGAGGAGAT pLKO.1 848 CDS 100% 4.050 2.835 N Kcnip1 n/a
5 TRCN0000069701 CTCTGTAAAGTTCGAGGACTT pLKO.1 740 CDS 100% 4.050 2.835 N Kcnip1 n/a
6 TRCN0000069698 GCTCTCAGAGACACTGACAAA pLKO.1 1100 3UTR 100% 4.950 2.970 N Kcnip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03137 pDONR223 100% 87% 94.7% None (many diffs) n/a
2 ccsbBroad304_03137 pLX_304 0% 87% 94.7% V5 (many diffs) n/a
3 TRCN0000476286 TTTTTTGGCACAAAAAACATGGGT pLX_317 53.2% 87% 94.7% V5 (many diffs) n/a
Download CSV