Transcript: Human XM_017009407.1

PREDICTED: Homo sapiens potassium voltage-gated channel interacting protein 1 (KCNIP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNIP1 (30820)
Length:
2018
CDS:
515..1192

Additional Resources:

NCBI RefSeq record:
XM_017009407.1
NBCI Gene record:
KCNIP1 (30820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430393 GTACTAAACAACCACCTTAAC pLKO_005 1229 3UTR 100% 10.800 15.120 N KCNIP1 n/a
2 TRCN0000044511 GCATCGTAACTTTAGATGAAT pLKO.1 1104 CDS 100% 5.625 7.875 N KCNIP1 n/a
3 TRCN0000420709 GGTCCCTCTGCTTAAGCTTAA pLKO_005 1475 3UTR 100% 10.800 8.640 N KCNIP1 n/a
4 TRCN0000419616 GATCTGCCCTTGTTCTGATTT pLKO_005 1255 3UTR 100% 13.200 9.240 N KCNIP1 n/a
5 TRCN0000415235 ACATTGTCAAAGCCATCTATG pLKO_005 987 CDS 100% 10.800 7.560 N KCNIP1 n/a
6 TRCN0000044508 CGAGAAACTAAGGTGGACATT pLKO.1 913 CDS 100% 4.950 3.465 N KCNIP1 n/a
7 TRCN0000044510 CGAAGACACATTCAAGCAGAT pLKO.1 751 CDS 100% 4.050 2.835 N KCNIP1 n/a
8 TRCN0000044512 CCATTACCTCTTCAATGCCTT pLKO.1 814 CDS 100% 2.640 1.848 N KCNIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03137 pDONR223 100% 90.3% 85.1% None (many diffs) n/a
2 ccsbBroad304_03137 pLX_304 0% 90.3% 85.1% V5 (many diffs) n/a
3 TRCN0000476286 TTTTTTGGCACAAAAAACATGGGT pLX_317 53.2% 90.3% 85.1% V5 (many diffs) n/a
Download CSV