Construct: ORF TRCN0000476307
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006855.1_s317c1
- Derived from:
- ccsbBroadEn_03436
- DNA Barcode:
- AGCTGCTTATCGGCATGTAGCCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDR5B (54554)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476307
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54554 | WDR5B | WD repeat domain 5B | NM_019069.4 | 100% | 100% | |
2 | human | 11091 | WDR5 | WD repeat domain 5 | NM_017588.3 | 79.8% | 85% | (many diffs) |
3 | human | 11091 | WDR5 | WD repeat domain 5 | NM_052821.3 | 79.8% | 85% | (many diffs) |
4 | human | 11091 | WDR5 | WD repeat domain 5 | XM_005272163.2 | 79.8% | 85% | (many diffs) |
5 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447393.1 | 79.8% | 85% | (many diffs) |
6 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447394.1 | 79.8% | 85% | (many diffs) |
7 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447395.1 | 79.8% | 85% | (many diffs) |
8 | mouse | 69544 | Wdr5b | WD repeat domain 5B | NM_027113.2 | 84.5% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1056
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aaccaaggag tcaagagacg ccaaagcaca gttggccctc tcctcatcgg 121 ccaatcagag caaggaagtg cctgaaaacc caaactatgc tctcaaatgt actcttgtgg 181 gacacacgga agcagtgtca tcagttaagt ttagtcctaa tggagaatgg ctagcaagtt 241 cttctgctga taggctaatc ataatttggg gagcatatga tggaaaatat gagaaaacac 301 tctatggtca taatttggaa atatcggatg ttgcctggtc atcagattcc agtcgtcttg 361 tttctgcctc agatgataaa actctaaaat tatgggatgt gagatctgga aaatgtttga 421 aaacactgaa ggggcacagt aattatgtct tttgttgtaa cttcaatccg ccatccaacc 481 ttataatctc gggatctttt gatgagactg taaaaatatg ggaggtgaaa acaggaaagt 541 gtctcaagac tttgtctgct cattctgacc cagtttctgc tgttcatttt aattgtagtg 601 ggtccttgat agtgtcaggt agctatgatg gcctctgtag aatctgggat gctgcatcag 661 gtcagtgttt aaaaacgctc gttgatgacg ataacccTCC TGTCTCTTTT GTAAAATTTT 721 CTCCAAATGG TAAATACATT CTCACTGCAA CTTTGGACAA CACTCTTAAA CTATGGGATT 781 ATAGCAGAGG CAGGTGCCTG AAAACATACA CTGGTCATAA GAATGAGAAA TATTGCATAT 841 TTGCCAATTT TTCAGTTACT GGTGGAAAGT GGATTGTGTC TGGTTCCGAG GATAACCTGG 901 TTTACATTTG GAACCTTCAG ACTAAAGAGA TTGTGCAGAA ATTACAAGGC CATACAGATG 961 TTGTGATCTC AGCAGCTTGT CATCCTACAG AAAACCTCAT CGCATCAGCA GCATTAGAAA 1021 ATGACAAAAC AATTAAACTG TGGATGAGTA ACCACTACCC AACTTTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 AAGCTGCTTA TCGGCATGTA GCCCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt