Transcript: Mouse NM_027113.2

Mus musculus WD repeat domain 5B (Wdr5b), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr5b (69544)
Length:
1806
CDS:
324..1310

Additional Resources:

NCBI RefSeq record:
NM_027113.2
NBCI Gene record:
Wdr5b (69544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257729 AGATTCTAGTCGTCTAGTTTC pLKO_005 596 CDS 100% 10.800 8.640 N Wdr5b n/a
2 TRCN0000246732 CGGCCATATCATCAGTTAAAT pLKO_005 442 CDS 100% 15.000 10.500 N Wdr5b n/a
3 TRCN0000246733 TGCAGCTGATGCACTAATTAT pLKO_005 494 CDS 100% 15.000 10.500 N Wdr5b n/a
4 TRCN0000246731 CTCTGGTTTGGGAGGTCATTA pLKO_005 1618 3UTR 100% 13.200 9.240 N Wdr5b n/a
5 TRCN0000217727 GGATTCTGGCAAAGCTTAAAC pLKO.1 1372 3UTR 100% 13.200 9.240 N Wdr5b n/a
6 TRCN0000257564 AGCCGCAGAAACCCAACTATG pLKO_005 391 CDS 100% 10.800 7.560 N Wdr5b n/a
7 TRCN0000189562 CCCAACTATGCTCTCAGACTT pLKO.1 402 CDS 100% 4.950 3.465 N Wdr5b n/a
8 TRCN0000192643 GCAACTTTGGACAATACTCTT pLKO.1 999 CDS 100% 4.950 3.465 N Wdr5b n/a
9 TRCN0000215340 CTGGTCATAAGAATGAGAAAT pLKO.1 1063 CDS 100% 13.200 7.920 N Wdr5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03436 pDONR223 100% 84.5% 83% None (many diffs) n/a
2 ccsbBroad304_03436 pLX_304 0% 84.5% 83% V5 (many diffs) n/a
3 TRCN0000476307 AGCTGCTTATCGGCATGTAGCCCG pLX_317 36.5% 84.5% 83% V5 (many diffs) n/a
Download CSV