Construct: ORF TRCN0000476312
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007230.1_s317c1
- Derived from:
- ccsbBroadEn_13599
- DNA Barcode:
- CCTAAAAAGTTAGTATCCAATATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACER2 (340485)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476312
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 340485 | ACER2 | alkaline ceramidase 2 | XM_005251448.3 | 100% | 100% | |
| 2 | human | 340485 | ACER2 | alkaline ceramidase 2 | XM_017014694.1 | 100% | 100% | |
| 3 | human | 340485 | ACER2 | alkaline ceramidase 2 | NM_001010887.3 | 82.1% | 82.1% | 1_147del |
| 4 | human | 340485 | ACER2 | alkaline ceramidase 2 | XM_011517859.2 | 81.8% | 81.8% | 0_1ins123 |
| 5 | human | 340485 | ACER2 | alkaline ceramidase 2 | XR_242506.2 | 53.2% | 1_305del;799_907del;995_996ins97 | |
| 6 | human | 340485 | ACER2 | alkaline ceramidase 2 | XR_002956781.1 | 47.8% | 1_305del;799_1040del;1133_1134ins92 | |
| 7 | human | 340485 | ACER2 | alkaline ceramidase 2 | XR_002956780.1 | 47.7% | 1_305del;799_1043del;1136_1137ins92 | |
| 8 | human | 340485 | ACER2 | alkaline ceramidase 2 | XM_011517858.1 | 47.5% | 42% | (many diffs) |
| 9 | human | 340485 | ACER2 | alkaline ceramidase 2 | XR_242507.3 | 11.9% | 1_305del;799_934del;1120_5659del | |
| 10 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | NM_139306.3 | 72% | 76% | (many diffs) |
| 11 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | XM_006537877.3 | 61.3% | 50.8% | (many diffs) |
| 12 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | NM_001290541.1 | 58.3% | 61.8% | (many diffs) |
| 13 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | NM_001290543.1 | 53.5% | 56.3% | (many diffs) |
| 14 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | XM_006537878.3 | 48.8% | 38% | (many diffs) |
| 15 | mouse | 230379 | Acer2 | alkaline ceramidase 2 | XM_011250012.2 | 47.3% | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 747
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtgcttgttt cgtcagtatg caacatgctt caacagtggc atctacttaa 121 tctggactct tttggttgta gtgggaattg gatccgtcta cttccatgca acccttagtt 181 tcttgggtca gatgcttgat gaacttgcag tcctttgggt tctgatgtgt gctttggcca 241 tgtggttccc cagaaggtat ctaccaaaga tctttcggaa tgaccggggt aggttcaagg 301 tggtggtcag tgtcctgtct gcggttacga cgtgcctggc atttgtcaag cctgccatca 361 acaacatctc tctgatgacc cTGGGAGTTC CTTGCACTGC ACTGCTCATC GCAGAGCTAA 421 AGAGGTGTGA CAACATGCGT GTGTTTAAGC TGGGCCTCTT CTCGGGCCTC TGGTGGACCC 481 TGGCCCTGTT CTGCTGGATC AGTGACCGAG CTTTCTGCGA GCTGCTGTCA TCCTTCAACT 541 TCCCCTACCT GCACTGCATG TGGCACATCC TCATCTGCCT TGCTGCCTAC CTGGGCTGTG 601 TATGCTTTGC CTACTTTGAT GCTGCCTCAG AGATTCCTGA GCAAGGCCCT GTCATCAAGT 661 TCTGGCCCAA TGAGAAATGG GCCTTCATTG GTGTCCCCTA TGTGTCCCTC CTGTGTGCCA 721 ACAAGAAATC ATCAGTCAAG ATCACGTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 781 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 841 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCTAAAAA 901 GTTAGTATCC AATATAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 961 aagatt