Transcript: Mouse XM_006537877.3

PREDICTED: Mus musculus alkaline ceramidase 2 (Acer2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acer2 (230379)
Length:
4233
CDS:
148..1008

Additional Resources:

NCBI RefSeq record:
XM_006537877.3
NBCI Gene record:
Acer2 (230379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537877.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192734 GCGATTTACAAGGCAGGAATA pLKO.1 2453 3UTR 100% 10.800 15.120 N Acer2 n/a
2 TRCN0000248162 TGCGAGGACAACTACACTATC pLKO_005 205 CDS 100% 10.800 15.120 N Acer2 n/a
3 TRCN0000248158 ACAGCGGCATCTACTTAATAT pLKO_005 329 CDS 100% 15.000 10.500 N Acer2 n/a
4 TRCN0000248159 CTCGGGAGCTGCCCTTATATA pLKO_005 2665 3UTR 100% 15.000 10.500 N Acer2 n/a
5 TRCN0000248160 TACAACGTGCTTGGCGTTTAT pLKO_005 552 CDS 100% 13.200 9.240 N Acer2 n/a
6 TRCN0000190704 GCAAGGTCCAGTCATCAGATT pLKO.1 821 CDS 100% 4.950 3.465 N Acer2 n/a
7 TRCN0000191214 CCATCAACAATATTTCCCTGA pLKO.1 581 CDS 100% 2.160 1.512 N Acer2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537877.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13599 pDONR223 100% 61.3% 50.8% None (many diffs) n/a
2 ccsbBroad304_13599 pLX_304 0% 61.3% 50.8% V5 (many diffs) n/a
3 TRCN0000476312 CCTAAAAAGTTAGTATCCAATATA pLX_317 53.6% 61.3% 50.8% V5 (many diffs) n/a
Download CSV