Construct: ORF TRCN0000476435
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013723.1_s317c1
- Derived from:
- ccsbBroadEn_13280
- DNA Barcode:
- TAGATTTAGTGCACGTTGACTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPNE9 (151835)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476435
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 151835 | CPNE9 | copine family member 9 | NM_001308388.2 | 100% | 100% | |
2 | human | 151835 | CPNE9 | copine family member 9 | NM_153635.3 | 90.3% | 89.3% | (many diffs) |
3 | human | 151835 | CPNE9 | copine family member 9 | XM_011533386.2 | 74.1% | 71.9% | (many diffs) |
4 | human | 151835 | CPNE9 | copine family member 9 | XR_001740032.1 | 70.3% | (many diffs) | |
5 | human | 151835 | CPNE9 | copine family member 9 | XM_011533388.2 | 58.8% | 57.2% | (many diffs) |
6 | human | 151835 | CPNE9 | copine family member 9 | XM_011533389.2 | 49.6% | 47.7% | (many diffs) |
7 | human | 151835 | CPNE9 | copine family member 9 | XM_017005747.1 | 40.6% | 35.3% | (many diffs) |
8 | human | 151835 | CPNE9 | copine family member 9 | XR_002959492.1 | 37.3% | (many diffs) | |
9 | mouse | 211232 | Cpne9 | copine family member IX | NM_170673.3 | 83.1% | 88.4% | (many diffs) |
10 | mouse | 211232 | Cpne9 | copine family member IX | XM_006505851.3 | 79.8% | 84.6% | (many diffs) |
11 | mouse | 211232 | Cpne9 | copine family member IX | XM_011241277.2 | 62.4% | 66.3% | (many diffs) |
12 | mouse | 211232 | Cpne9 | copine family member IX | XM_006505852.3 | 58.1% | 61.8% | (many diffs) |
13 | mouse | 211232 | Cpne9 | copine family member IX | XM_017321489.1 | 58.1% | 61.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1578
- ORF length:
- 1509
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctctcggc ggagcctccg agcgcagcgt cccggccacc aagattgaaa 121 ttaccgtgtc ctgccggaac ctgctagacc ttgatacctt ctccaagtcc gaccccatgg 181 tggtgcttta cacgcagagc cgggccagcc aggagtggcg ggagttcgga cggaccgagg 241 tgattgataa cacgctgaac ccagacttcg tgcgcaaatt cgtcctcgac tatttctttg 301 aggaaaagca aaatctgcgc ttcgatgtgt acaacgtgga ctccaaaacc aacatctcca 361 aaccgaagga tttcctggga caagcgttcc tggccctggg agaggtgatt ggaggccagg 421 gcagccgagt agagcgaacc ctcacgggtg taccaggcaa gaagtgtggg accatattgc 481 tgactgcaga agagcttagc aattgtcggg acattgccac catgcagctg tgtgcaaaca 541 agctggacaa gaaggacttc tttgggaaat cagacccctt ccttgtgttc tacaggagca 601 atgaggatgg cacgttcacc atctgccaca agacagaggt tgtgaaaaac acgctgaatc 661 ctgtgtggca gcccttcagc atccctgtgc gggctctgtg caatggagac tatgacagaa 721 cggtgaagat tgatgtgtac gactgggacc gggatggaag ccacgatttc attggtgagt 781 tcaccaccag ctaccgggag ctgagcaagg cccagaacca gttcacagta tatgaggttc 841 ttaaccctcg gaagaaatgt aagaagaaga aatatgtcaa ctcaggaact gtgacgctgc 901 tctccttctc tgtggactct gaattcactt ttgttgatta catcaaggga gggacacagc 961 tgaacttcac agtagccatt gacttcacgg cttccaatgg gaatcctctg cagcctacct 1021 ccctgcacta catgagtccc taccagctca gcgcctatgc catggccctc aaggcagtgg 1081 gagagatcat ccaggactat gacagtgata agctcttccc agcttatggc tttggggcca 1141 agctgccccc agagggacgg atctcccacc agttccccct GAACAACAAT GATGAGGACC 1201 CCAACTGTGC GGGCATCGAG GGTGTGCTGG AGAGCTATTT CCAGAGCCTG CGCACAGTGC 1261 AGCTCTATGG GCCCACCTAC TTTGCTCCTG TCATCAACCA AGTGGCCAGG GCTGCAGCCA 1321 AGATCTCTGA TGGCTCCCAG TACTATGTTC TGCTCATCAT CACTGATGGG GTCATCTCTG 1381 ACATGACGCA GACCAAGGAG GCCATCGTCA GCGCCTCCTC ATTGCCCATG TCTATCATTA 1441 TCGTCGGTGT AGGACCAGCC ATGTTTGAGG CAATGGAAGA GTTGGACGGT GATGATGTGC 1501 GCGTGTCCTC TAGGGGACGC TACGCAGAGC GGGACATCGT TCAGGAAGGT TGCTGCAGCC 1561 TTGGCACATC CGTGGTGTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1621 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1681 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATAGATTT AGTGCACGTT 1741 GACTTTCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt