Transcript: Mouse XM_006505851.3

PREDICTED: Mus musculus copine family member IX (Cpne9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpne9 (211232)
Length:
2161
CDS:
347..1954

Additional Resources:

NCBI RefSeq record:
XM_006505851.3
NBCI Gene record:
Cpne9 (211232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505851.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111613 GCAAATTCGTTCTCGACTATT pLKO.1 498 CDS 100% 13.200 18.480 N Cpne9 n/a
2 TRCN0000111614 CGCAAATTCGTTCTCGACTAT pLKO.1 497 CDS 100% 4.950 6.930 N Cpne9 n/a
3 TRCN0000111611 CCCTCGGAAGAAATGCAAGAA pLKO.1 1069 CDS 100% 4.950 3.465 N Cpne9 n/a
4 TRCN0000111612 CCTTGTGTTCTACAGGAGCAA pLKO.1 805 CDS 100% 2.640 1.848 N Cpne9 n/a
5 TRCN0000111610 CCAATGCTTAGCAGTCTGCTT pLKO.1 1968 3UTR 100% 2.640 1.584 N Cpne9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505851.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13280 pDONR223 100% 79.8% 84.6% None (many diffs) n/a
2 ccsbBroad304_13280 pLX_304 0% 79.8% 84.6% V5 (many diffs) n/a
3 TRCN0000476435 TAGATTTAGTGCACGTTGACTTTC pLX_317 26.6% 79.8% 84.6% V5 (many diffs) n/a
Download CSV