Construct: ORF TRCN0000476459
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014578.1_s317c1
- Derived from:
- ccsbBroadEn_13036
- DNA Barcode:
- CTACCTAGCAAGGCACGAGCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CSMD2 (114784)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476459
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_017000193.1 | 7.3% | 7.3% | (many diffs) |
| 2 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_017000192.1 | 7.3% | 7.2% | (many diffs) |
| 3 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_017000191.1 | 5.7% | 5.6% | (many diffs) |
| 4 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | NM_052896.4 | 4.8% | 4.8% | (many diffs) |
| 5 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_017000188.1 | 4.7% | 4.7% | (many diffs) |
| 6 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_017000185.1 | 4.7% | 4.7% | (many diffs) |
| 7 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | NM_001281956.1 | 4.7% | 4.6% | (many diffs) |
| 8 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XM_024452878.1 | 4.7% | 4.6% | (many diffs) |
| 9 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XR_002959295.1 | 4.6% | (many diffs) | |
| 10 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XR_002959296.1 | 3.8% | (many diffs) | |
| 11 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XR_002959291.1 | 3.8% | (many diffs) | |
| 12 | human | 114784 | CSMD2 | CUB and Sushi multiple doma... | XR_002959290.1 | 3.7% | (many diffs) | |
| 13 | mouse | 329942 | Csmd2 | CUB and Sushi multiple doma... | XR_867884.2 | 5.1% | (many diffs) | |
| 14 | mouse | 329942 | Csmd2 | CUB and Sushi multiple doma... | NM_001281955.1 | 4.2% | 4.4% | (many diffs) |
| 15 | mouse | 329942 | Csmd2 | CUB and Sushi multiple doma... | XM_011240560.2 | 4.2% | 4.4% | (many diffs) |
| 16 | mouse | 329942 | Csmd2 | CUB and Sushi multiple doma... | XR_001784159.1 | 3.3% | (many diffs) | |
| 17 | mouse | 329942 | Csmd2 | CUB and Sushi multiple doma... | XR_001784158.1 | 3.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 741
- ORF length:
- 675
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg tgatgcccac cttcgaggcc cctcgggcat catcacctcc cccaatttcc 121 ccattcagta tgacaacaat gcacactgtg tgtggatcat cacagcactc aacccctcca 181 aggtgggagg agacccaggg aacatacaat gcaacaagga gggtctaagt gtggaaactc 241 aaagtctaag actgaggaat agaagttgtc ttctgggaaa cagcaaggac aatggatgct 301 gtgtgcctaa ccctgttcat ggaactggcc tacaggtgat caagctcgcc tttgaggagt 361 ttgatttGGA GAGGGGCTAT GACACCCTGA CGGTCGGTGA TGGTGGTCAG GATGGGGACC 421 AGAAGACAGT TCTCTACATC CTGACAGGTA CATCGGTCCC GGATCTCATT GTCAGCACCA 481 ATCATCAAAT GTGGCTCCTC TTCCAGACTG ATGGCAGTGG CAGTTCCCTG GGATTCAAGG 541 CTTCTTATGA AGAGATCGAG CAGGGCAGTT GCGGTGACCC TGGCATACCT GCATATGGCC 601 GGAGGGAAGG CTCCCGGTTT CACCACGGTG ACACACTCAA GTTTGAGTGC CAGCCCGCCT 661 TTGAGCTGGT GGGACAGAAG GCAATCACAT GCCAAAAGAA TAACCAATGG TCGGCTAAGA 721 AGCCAGGCTG CGTGTGTAAG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 781 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 841 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTAC CTAGCAAGGC 901 ACGAGCGCCA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt