Transcript: Human XR_002959291.1

PREDICTED: Homo sapiens CUB and Sushi multiple domains 2 (CSMD2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSMD2 (114784)
Length:
13433
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959291.1
NBCI Gene record:
CSMD2 (114784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161280 GCACCTGGATTATCGAAACAT pLKO.1 2969 3UTR 100% 5.625 3.938 N CSMD2 n/a
2 TRCN0000160506 CCTTGTAAAGTTCCATGAGAT pLKO.1 12885 3UTR 100% 4.950 3.465 N CSMD2 n/a
3 TRCN0000159534 CGAGAAGCAATATGATGAGTT pLKO.1 7206 3UTR 100% 4.950 3.465 N CSMD2 n/a
4 TRCN0000159957 GAGAAGCAATATGATGAGTTT pLKO.1 7207 3UTR 100% 4.950 3.465 N CSMD2 n/a
5 TRCN0000159379 GCAAAGGTAAAGACAGAGTTA pLKO.1 11894 3UTR 100% 4.950 3.465 N CSMD2 n/a
6 TRCN0000162396 CCCAATTTCTTATGCTCCCTT pLKO.1 12759 3UTR 100% 2.640 1.848 N CSMD2 n/a
7 TRCN0000087593 CAGCTCCGCTATGAGACTATT pLKO.1 2680 3UTR 100% 13.200 9.240 N LOC381556 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13036 pDONR223 100% 3.8% None (many diffs) n/a
2 ccsbBroad304_13036 pLX_304 0% 3.8% V5 (many diffs) n/a
3 TRCN0000476459 CTACCTAGCAAGGCACGAGCGCCA pLX_317 55.2% 3.8% V5 (many diffs) n/a
Download CSV