Transcript: Mouse XM_011240560.2

PREDICTED: Mus musculus CUB and Sushi multiple domains 2 (Csmd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csmd2 (329942)
Length:
14600
CDS:
270..11108

Additional Resources:

NCBI RefSeq record:
XM_011240560.2
NBCI Gene record:
Csmd2 (329942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087219 GCTGGCTATAATGTTGGACAA pLKO.1 6687 CDS 100% 4.050 3.240 N LOC433758 n/a
2 TRCN0000087593 CAGCTCCGCTATGAGACTATT pLKO.1 2964 CDS 100% 13.200 9.240 N LOC381556 n/a
3 TRCN0000087594 GCGTGTTCTTTACTTTCCATA pLKO.1 3286 CDS 100% 4.950 3.465 N LOC381556 n/a
4 TRCN0000087595 CTCCATGTCCTATGAGGGATT pLKO.1 3464 CDS 100% 4.050 2.835 N LOC381556 n/a
5 TRCN0000087221 CCACGATAGCATCGTGTACTT pLKO.1 6557 CDS 100% 0.495 0.347 N LOC433758 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13036 pDONR223 100% 4.2% 4.4% None (many diffs) n/a
2 ccsbBroad304_13036 pLX_304 0% 4.2% 4.4% V5 (many diffs) n/a
3 TRCN0000476459 CTACCTAGCAAGGCACGAGCGCCA pLX_317 55.2% 4.2% 4.4% V5 (many diffs) n/a
Download CSV