Construct: ORF TRCN0000476471
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010808.1_s317c1
- Derived from:
- ccsbBroadEn_04503
- DNA Barcode:
- ATCCAATTGGGACATCCTATATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBE3D (90025)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476471
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NM_198920.3 | 100% | 100% | |
| 2 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_011536241.3 | 98.7% | 98.7% | (many diffs) |
| 3 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_017011458.2 | 97.1% | 96.2% | (many diffs) |
| 4 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_017011459.2 | 96.8% | 97.7% | 1150_1151insTGGCCTTTTTGA;1154G>T;1156_1179del |
| 5 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_011536240.2 | 96.3% | 96.7% | 1151_1152delCAinsTGGCCTTTTT;1157_1158insT;1159_1191del |
| 6 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_011536239.3 | 95.9% | 95% | (many diffs) |
| 7 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NM_001304437.1 | 91.7% | 91.7% | 0_1ins96 |
| 8 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NM_001350602.1 | 91.7% | 91.7% | 0_1ins96 |
| 9 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_017011460.1 | 91.7% | 91.7% | 0_1ins96 |
| 10 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_011536238.3 | 83.1% | 81.8% | 1149_1266del;1286_1404del |
| 11 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XR_002956314.1 | 61.1% | (many diffs) | |
| 12 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XR_001743730.2 | 60.6% | 1_94del;760_864del;1367_1924del | |
| 13 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XR_001743726.2 | 60.1% | 1_94del;759_880del;1384_1941del | |
| 14 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NR_146809.1 | 59.5% | 1_123del;942_943ins26;1265_1891del | |
| 15 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XR_002956315.1 | 58.4% | 1_94del;830_1006del;1439_1996del | |
| 16 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NR_146808.1 | 55.9% | (many diffs) | |
| 17 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NM_001350603.1 | 51.9% | 51.9% | 0_1ins561 |
| 18 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NM_001350604.1 | 51.9% | 51.9% | 0_1ins561 |
| 19 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | XM_011536242.1 | 43.1% | 41.8% | 0_1ins561;588_705del;725_843del |
| 20 | human | 90025 | UBE3D | ubiquitin protein ligase E3D | NR_146807.2 | 37.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1236
- ORF length:
- 1167
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggcttct gcggcggaga cgcgcgtgtt tctggaggtg cggggacagc 121 tgcagagcgc gcttctgatc ctgggagaac cgaaagaagg aggtatgccc atgaatattt 181 ccataatgcc atcttcactc cagatgaaaa cccctgaagg ctgcacagaa atccagcttc 241 cagcagaggt caggcttgta ccttcctctt gccgtgggct acagtttgtt gttggagatg 301 gactgcacct gcgactgcag acgcaagcaa aattaggcac aaaactgatt tcaatgttta 361 atcaaagctc gcaaacccaa gaatgttgca cgttttattg ccaatcctgc ggtgaagtca 421 taataaaaga caggaagctc ctcagggtgc tcccactgcc gagtgagaac tggggagctc 481 tagttggaga atggtgttgt catcctgacc cctttgctaa taaatcactt catccgcaag 541 agaatgactg ttttattgga gactctttct tcttggtgaa tttaagaacc agtttgtggc 601 agcaaagacc tgaactatcc ccagtggaga tgtgctgtgt ttcttctgac aaccattgta 661 aattggaacc aaaggcaaat accaaagtaa tttgtaagcg ttgcaaggta atgttgggag 721 agaccgtgtc atcagaaacc accaagtttt atatgacaga gataattatt cagtcatctg 781 agaggagttt tcctatcata ccaaggtctt ggtttgtcca gagcgtgatc gcccagtgtc 841 tggtgcagct ctccTCTGCT AGAAGCACTT TTAGATTCAC GATTCAAGGT CAGGATGACA 901 AAGTGTATAT CTTGCTATGG CTTTTAAATT CAGACAGTTT GGTGATTGAA TCTTTGAGAA 961 ATTCCAAATA TATCAAAAAA TTCCCCTTGT TGGAAAACAC ATTCAAAGCC GATTCTAGTT 1021 CTGCCTGGAG TGCTGTCAAG GTCCTCTACC AGCCATGCAT CAAAAGCAGG AATGAAAAAC 1081 TTGTCAGCTT GTGGGAAAGT GACATCAGCG TCCACCCGCT AACCCTGCCC TCTGCAACCT 1141 GCTTGGAGCT GCTGTTGATA TTGTCAAAGA GTAATGCCAA TCTGCCTTCA TCCCTTCGCC 1201 GTGTGAATTC CTTTCAGGTG GCCTTTTTGA AGATGTTGCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGCCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 AATCCAATTG GGACATCCTA TATAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt